Gene detail

Detail information of GWHGAAZE033855

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007163327.1	3.8346E-57	hypothetical protein PHAVU_001G225400g [Phaseolus vulgaris]
Swissprot	tr\|O04834\|SAR1A_ARATH	2E-51	GTP-binding protein SAR1A
trEMBL	tr\|V7D286\|V7D286_PHAVU	1E-57	Uncharacterized protein {ECO:0000313\|EMBL:ESW35321.1}
TAIR10	AT3G62560.1	1E-31	Ras-related small GTP-binding family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000141	gene	1288279	1293033	-
GWHAAZE00000141	mRNA	1288279	1293033	-
GWHAAZE00000141	exon	1292905	1293033	-
GWHAAZE00000141	exon	1288279	1288461	-
GWHAAZE00000141	CDS	1292905	1293033	-
GWHAAZE00000141	CDS	1288279	1288461	-

Transcript Sequence
>GWHTAAZE033895 ATGTTTTTGCTGGATTGGTTCTATGGAGTTCTCGCATCGCTAGGTCTTTGGCAGAAAGAGGCGAAGATCTTGTTCTTAGGGCTCGATAATGCCGGTAAAACGACGTTGCTTCATATGTTGAAAGACGAGGTGGACGCGGTGGTTTACCTGGTGGACGCATACGACAAGGAGAGGTTCGCCGAGTCCAAGAAAGAGCTAGACGCGCTACTCTCAGACGAGTCATTGGCAAACGTGCCGTTTCTGATACTGGGCAACAAGATCGACATCCCTTATGCTGCCTCGAAGACGAAGCACGCTACAACATGGGTCTGA

Network for GWHGAAZE033855

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00025.22	Arf	43	98	1.00E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07953	SAR1	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.749
	SRR3591706	second leaf	27.073
	SRR3591707	mature leaf	11.753
	SRR3591708	Shoot apex	35.914
	SRR3591709	Stem	17.419
	SRR3591710	White floral bud	25.618
	SRR3591711	White flower	22.544
	SRR3591712	Green floral bud	40.936
	SRR3591713	Yellow flower	17.122
SRP173429	SRR8316895	Juvenile bud stage	17.727
	SRR8316896	Juvenile bud stage	27.428
	SRR8316897	Juvenile bud stage	13.459
	SRR8316894	Third green stage	9.665
	SRR8316900	Third green stage	29.285
	SRR8316901	Third green stage	27.701
	SRR8316898	Complete white stage	11.001
	SRR8316899	Complete white stage	32.449
	SRR8316903	Complete white stage	21.538
	SRR8316902	Silver flowering stage	16.603
	SRR8316904	Silver flowering stage	11.936
	SRR8316905	Silver flowering stage	2.890
	SRR8316906	Gold flowering stage	4.995
	SRR8316907	Gold flowering stage	4.507
	SRR8316908	Gold flowering stage	6.846
SRP132670	SRR6706286	Control	11.024
	SRR6706287	Light intensity 50%	11.631
	SRR6706288	Light intensity 20%	12.668
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.053
	CNS0095593	Slightly white alabastrum(diploid) 2	22.908
	CNS0095594	Slightly white alabastrum(diploid) 3	20.466
	CNS0095595	Whole white alabastrum(diploid) 2	15.495
	CNS0095596	Whole white alabastrum(diploid) 3	20.969
	CNS0095597	Whole white alabastrum(diploid) 4	14.041
	CNS0095598	Silvery flower (diploied) 1	7.978
	CNS0095599	Silvery flower (diploied) 2	6.063
	CNS0095600	Silvery flower (diploied) 3	5.020
	CNS0095601	Golden flower (diploid) 1	9.330
	CNS0095602	Golden flower (diploid) 2	7.592
	CNS0095603	Golden flower (diploid) 3	4.151
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.145
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.186
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.741
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.006
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.819
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.880
	CNS0095610	Silvery flower (tetraploid) 1	5.160
	CNS0095611	Silvery flower (tetraploid) 2	4.140
	CNS0095612	Silvery flower (tetraploid) 3	4.091
	CNS0095613	Golden flower (tetraploid) 1	3.629
	CNS0095614	Golden flower (tetraploid) 2	4.709
	CNS0095615	Golden flower (tetraploid) 3	3.556
CRA001975	CRR073297	Stem 1	13.993
	CRR073298	Stem 2	12.681
	CRR073299	Stem 3	18.487
	CRR073300	Leaf 1	16.483
	CRR073301	Leaf 2	14.203
	CRR073302	Leaf 3	15.231
	CRR073303	Juvenile bud 1	13.195
	CRR073304	Juvenile bud 2	10.844
	CRR073305	Juvenile bud 3	10.590
	CRR073306	Third green 1	3.268
	CRR073307	Third green 2	2.188
	CRR073308	Third green 3	3.175
	CRR073309	Second white 1	3.698
	CRR073310	Second white 2	2.107
	CRR073311	Second white 3	0.231
	CRR073312	Silver flowering 1	1.727
	CRR073313	Silver flowering 2	2.690
	CRR073314	Silver flowering 3	1.431
	CRR073315	Gold flowering 1	5.824
	CRR073316	Gold flowering 2	5.871
	CRR073317	Gold flowering 3	11.275
	CRR073318	Tawny withering 1	9.988
	CRR073319	Tawny withering 2	6.204
	CRR073320	Tawny withering 3	8.973