Gene detail

Detail information of GWHGAAZE033789

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHF22089.1	6.26625E-37	CYP79D33 [Maesa lanceolata]
Swissprot	tr\|Q6J541\|C79D3_LOTJA	1E-33	Isoleucine N-monooxygenase 1
trEMBL	tr\|A0A0A0LXQ7\|A0A0A0LXQ7_CUCSA	2E-35	Uncharacterized protein {ECO:0000313\|EMBL:KGN66523.1}
TAIR10	AT4G39950.1	3E-25	cytochrome P450, family 79, subfamily B, polypeptide 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000138	gene	180389	181401	+
GWHAAZE00000138	mRNA	180389	181401	+
GWHAAZE00000138	exon	180389	180715	+
GWHAAZE00000138	exon	181276	181401	+
GWHAAZE00000138	CDS	180389	180715	+
GWHAAZE00000138	CDS	181276	181401	+

Transcript Sequence
>GWHTAAZE033829 ATGCAAGATGGAGGACCAGGAGCTGAAGAAGAAGAGCATGTCAGCGCGCTTTTCAAAATCCTCGATTACACATTTTCCTTTTGTGTTTCTGACTACGTTGGGTTTTTACGTGGGCGGTTTGATTTAGATGGTCACGAAAATATCATTAGAATGGCAGTTGAAAGTGTGAGGAAGTATCAAGATCCTTTAATAGACGAGAGAGTTCAACAATGGGCAAAAGGTACCAAGACAGTGAAAGAAGACTTGCTTGATGTCATGCTCTCTCTCCAGAATGAAGACTTGGGCACGAAATTATTGTCTGTTGATGAGATCAAAGCCCAAATTATTCGAGGCTTCTTCAATGCTTCACCGAGTGCTTCACCTATTAAGCCACACATTGACCTCAGTGAGTCATATGAAAGTTTGGTTATGGCAAAACCTTTACATGCACTTTCGCCGGCGCTTGGGAGATAA

Network for GWHGAAZE033789

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.125
	SRR8316896	Juvenile bud stage	0.130
	SRR8316897	Juvenile bud stage	0.027
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.420
	SRR8316898	Complete white stage	4.693
	SRR8316899	Complete white stage	0.296
	SRR8316903	Complete white stage	5.162
	SRR8316902	Silver flowering stage	3.211
	SRR8316904	Silver flowering stage	4.503
	SRR8316905	Silver flowering stage	4.190
	SRR8316906	Gold flowering stage	9.721
	SRR8316907	Gold flowering stage	8.863
	SRR8316908	Gold flowering stage	3.895
SRP132670	SRR6706286	Control	0.211
	SRR6706287	Light intensity 50%	0.231
	SRR6706288	Light intensity 20%	0.166
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.081
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.079
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	1.994
	CNS0095601	Golden flower (diploid) 1	0.248
	CNS0095602	Golden flower (diploid) 2	1.520
	CNS0095603	Golden flower (diploid) 3	1.040
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.048
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.048
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.214
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.113
	CNS0095610	Silvery flower (tetraploid) 1	5.241
	CNS0095611	Silvery flower (tetraploid) 2	3.732
	CNS0095612	Silvery flower (tetraploid) 3	24.368
	CNS0095613	Golden flower (tetraploid) 1	9.106
	CNS0095614	Golden flower (tetraploid) 2	6.139
	CNS0095615	Golden flower (tetraploid) 3	7.970
CRA001975	CRR073297	Stem 1	0.240
	CRR073298	Stem 2	0.204
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.129
	CRR073303	Juvenile bud 1	0.149
	CRR073304	Juvenile bud 2	7.474
	CRR073305	Juvenile bud 3	0.372
	CRR073306	Third green 1	14.556
	CRR073307	Third green 2	17.792
	CRR073308	Third green 3	10.634
	CRR073309	Second white 1	9.282
	CRR073310	Second white 2	14.556
	CRR073311	Second white 3	21.719
	CRR073312	Silver flowering 1	7.500
	CRR073313	Silver flowering 2	5.297
	CRR073314	Silver flowering 3	7.180
	CRR073315	Gold flowering 1	2.899
	CRR073316	Gold flowering 2	3.637
	CRR073317	Gold flowering 3	1.988
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.183
	CRR073320	Tawny withering 3	0.000