Gene detail

Detail information of GWHGAAZE033771

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EPS59569.1	3.59148E-55	hypothetical protein M569_15236, partial [Genlisea aurea]
COG	YP_003435202.1	5E-28	30S ribosomal protein S12
Swissprot	tr\|Q9M5Z9\|RS23_EUPES	2E-57	40S ribosomal protein S23
trEMBL	tr\|S8BYT7\|S8BYT7_9LAMI	1E-55	Uncharacterized protein {ECO:0000313\|EMBL:EPS59569.1} (Fragment)
TAIR10	AT5G02960.1	3E-45	Ribosomal protein S12/S23 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000134	gene	1341712	1342317	-
GWHAAZE00000134	mRNA	1341712	1342317	-
GWHAAZE00000134	exon	1341712	1341792	-
GWHAAZE00000134	exon	1341990	1342116	-
GWHAAZE00000134	exon	1342208	1342317	-
GWHAAZE00000134	CDS	1342208	1342317	-
GWHAAZE00000134	CDS	1341990	1342116	-
GWHAAZE00000134	CDS	1341712	1341792	-

Transcript Sequence
>GWHTAAZE033811 ATGGGTGACAAGTTTTACAAAAAATCGCATCCTGGAAATGAATGGAAAAAGCCTTTTGCAGGGTATTCCAATGCAAAAGGAATTGTCCTCGAAAAGATGAAGTCTAAAAATGGGATTGAGGCTAAGCAGCCCAACTCTACTATCAGAAAGTTTGCTCGTGTTCAGCTGATTAAAAATGGGAAGAAGATTGCTGCCTTTGTACCCAATGATGGTTGCTTAAACTATATTGAGGAAAATGATGAAGTGTTGATTGCAGGATTCGAAAGGAAGGGGCATGCTGTGGGAGATATTCCTGGAGTGAAGTTCAAGGCTGTGAAG

Network for GWHGAAZE033771

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00164.26	Ribosom_S12_S23	14	106	9.90E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02973	RP-S23e, RPS23	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.324
	SRR3591706	second leaf	15.274
	SRR3591707	mature leaf	15.373
	SRR3591708	Shoot apex	20.888
	SRR3591709	Stem	20.387
	SRR3591710	White floral bud	11.046
	SRR3591711	White flower	10.797
	SRR3591712	Green floral bud	11.557
	SRR3591713	Yellow flower	10.725
SRP173429	SRR8316895	Juvenile bud stage	5.403
	SRR8316896	Juvenile bud stage	7.423
	SRR8316897	Juvenile bud stage	1.920
	SRR8316894	Third green stage	3.817
	SRR8316900	Third green stage	9.887
	SRR8316901	Third green stage	8.401
	SRR8316898	Complete white stage	3.996
	SRR8316899	Complete white stage	7.230
	SRR8316903	Complete white stage	3.707
	SRR8316902	Silver flowering stage	3.031
	SRR8316904	Silver flowering stage	5.669
	SRR8316905	Silver flowering stage	1.902
	SRR8316906	Gold flowering stage	6.650
	SRR8316907	Gold flowering stage	7.454
	SRR8316908	Gold flowering stage	5.745
SRP132670	SRR6706286	Control	2.121
	SRR6706287	Light intensity 50%	2.019
	SRR6706288	Light intensity 20%	1.849
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.715
	CNS0095593	Slightly white alabastrum(diploid) 2	5.765
	CNS0095594	Slightly white alabastrum(diploid) 3	3.834
	CNS0095595	Whole white alabastrum(diploid) 2	6.533
	CNS0095596	Whole white alabastrum(diploid) 3	6.131
	CNS0095597	Whole white alabastrum(diploid) 4	7.830
	CNS0095598	Silvery flower (diploied) 1	6.643
	CNS0095599	Silvery flower (diploied) 2	2.685
	CNS0095600	Silvery flower (diploied) 3	4.239
	CNS0095601	Golden flower (diploid) 1	6.350
	CNS0095602	Golden flower (diploid) 2	6.723
	CNS0095603	Golden flower (diploid) 3	4.496
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.232
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.743
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.173
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.073
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.426
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.137
	CNS0095610	Silvery flower (tetraploid) 1	7.446
	CNS0095611	Silvery flower (tetraploid) 2	9.531
	CNS0095612	Silvery flower (tetraploid) 3	8.900
	CNS0095613	Golden flower (tetraploid) 1	6.047
	CNS0095614	Golden flower (tetraploid) 2	7.197
	CNS0095615	Golden flower (tetraploid) 3	3.572
CRA001975	CRR073297	Stem 1	8.649
	CRR073298	Stem 2	5.974
	CRR073299	Stem 3	2.338
	CRR073300	Leaf 1	5.472
	CRR073301	Leaf 2	3.937
	CRR073302	Leaf 3	1.429
	CRR073303	Juvenile bud 1	1.374
	CRR073304	Juvenile bud 2	1.352
	CRR073305	Juvenile bud 3	1.927
	CRR073306	Third green 1	0.164
	CRR073307	Third green 2	0.194
	CRR073308	Third green 3	0.503
	CRR073309	Second white 1	1.280
	CRR073310	Second white 2	0.248
	CRR073311	Second white 3	0.542
	CRR073312	Silver flowering 1	0.253
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.187
	CRR073315	Gold flowering 1	0.577
	CRR073316	Gold flowering 2	0.928
	CRR073317	Gold flowering 3	0.010
	CRR073318	Tawny withering 1	5.221
	CRR073319	Tawny withering 2	8.150
	CRR073320	Tawny withering 3	3.772