Gene detail

Detail information of GWHGAAZE033744

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011097901.1	2.33805E-64	PREDICTED: DNA polymerase I B, chloroplastic/mitochondrial [Sesamum indicum]
COG	YP_004013487.1	2E-13	DNA polymerase I
Swissprot	tr\|Q6Z4T3\|POLIB_ORYSJ	9E-61	DNA polymerase I B, mitochondrial (Precursor)
trEMBL	tr\|A0A068UBD4\|A0A068UBD4_COFCA	6E-64	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05771.1}
TAIR10	AT1G50840.1	4E-53	polymerase gamma 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000130	gene	750166	752427	+
GWHAAZE00000130	mRNA	750166	752427	+
GWHAAZE00000130	exon	750166	750213	+
GWHAAZE00000130	exon	750307	750402	+
GWHAAZE00000130	exon	751129	751221	+
GWHAAZE00000130	exon	751639	751833	+
GWHAAZE00000130	exon	752401	752427	+
GWHAAZE00000130	CDS	750166	750213	+
GWHAAZE00000130	CDS	750307	750402	+
GWHAAZE00000130	CDS	751129	751221	+
GWHAAZE00000130	CDS	751639	751833	+
GWHAAZE00000130	CDS	752401	752427	+

Transcript Sequence
>GWHTAAZE033784 ATGGAGCTAGAGAATCTCAAGTCTCACATTGAAAATTTCCCAGTTCGAGGCACTCATATATCAGGCAAGAACGGGTGCATTCATTGTTATCTAAATATCAACACAGAAGCTGGGTGCTTATCTTCTAGGAAACTGGATTTGCAGAATCAGCCTTCTTTAGAGAAGGACAGATTCAAGATCCGCCAGACATTTATGGCTGCACCAGATAACTCTCTCATTGTTGCTGATTATGGGCAGTTGGAACATAGGATTATTGTACATCTTTCAAACTGTCGAAGCATGTTGGATGCCTTCAATGTTGGTGTAGACTTCCATTCAAATACTACAATGAACTTGTATCCACACATTCGTGATGCCATTGAACTAAAGCATGTGCTTCTTGAGTGGCATCCACAACCTAGTGAAGACAAGCCTCTGGTTCCTCTTGTAAAGGAAGAAGTTGGGAGTGTATCAAAGTAG

Network for GWHGAAZE033744

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00476.21	DNA_pol_A	19	113	5.70E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02335	polA	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420
		Homologous recombination	map03440

Gene Ontology

GO term	Ontology	Name
GO:0006261	biological_process	DNA-dependent DNA replication
GO:0006260	biological_process	DNA replication
GO:0003887	molecular_function	DNA-directed DNA polymerase activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.055
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.048
	SRR3591708	Shoot apex	0.021
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.039
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.063
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.622
	SRR8316896	Juvenile bud stage	2.309
	SRR8316897	Juvenile bud stage	0.270
	SRR8316894	Third green stage	0.605
	SRR8316900	Third green stage	2.141
	SRR8316901	Third green stage	2.471
	SRR8316898	Complete white stage	0.796
	SRR8316899	Complete white stage	1.850
	SRR8316903	Complete white stage	1.187
	SRR8316902	Silver flowering stage	0.544
	SRR8316904	Silver flowering stage	0.567
	SRR8316905	Silver flowering stage	0.697
	SRR8316906	Gold flowering stage	1.910
	SRR8316907	Gold flowering stage	3.216
	SRR8316908	Gold flowering stage	0.391
SRP132670	SRR6706286	Control	0.681
	SRR6706287	Light intensity 50%	0.445
	SRR6706288	Light intensity 20%	0.906
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.244
	CNS0095593	Slightly white alabastrum(diploid) 2	0.615
	CNS0095594	Slightly white alabastrum(diploid) 3	2.584
	CNS0095595	Whole white alabastrum(diploid) 2	1.476
	CNS0095596	Whole white alabastrum(diploid) 3	0.710
	CNS0095597	Whole white alabastrum(diploid) 4	1.884
	CNS0095598	Silvery flower (diploied) 1	1.422
	CNS0095599	Silvery flower (diploied) 2	0.413
	CNS0095600	Silvery flower (diploied) 3	0.547
	CNS0095601	Golden flower (diploid) 1	0.596
	CNS0095602	Golden flower (diploid) 2	1.038
	CNS0095603	Golden flower (diploid) 3	1.387
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.121
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.036
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.128
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.008
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.012
CRA001975	CRR073297	Stem 1	0.894
	CRR073298	Stem 2	0.731
	CRR073299	Stem 3	0.558
	CRR073300	Leaf 1	0.750
	CRR073301	Leaf 2	0.736
	CRR073302	Leaf 3	0.212
	CRR073303	Juvenile bud 1	0.478
	CRR073304	Juvenile bud 2	0.272
	CRR073305	Juvenile bud 3	0.230
	CRR073306	Third green 1	0.124
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.031
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.109
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.714
	CRR073314	Silver flowering 3	0.087
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.104
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.069
	CRR073319	Tawny withering 2	0.522
	CRR073320	Tawny withering 3	0.000