Gene detail

Detail information of GWHGAAZE033500

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010246190.1	4.7578E-105	PREDICTED: 50S ribosomal protein L12, chloroplastic-like [Nelumbo nucifera]
COG	YP_004063235.1	5E-15	50S ribosomal protein L12
Swissprot	tr\|Q1ACG9\|RK12_CHAVU	1E-13	50S ribosomal protein L12, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00368}
trEMBL	tr\|A0A068VD50\|A0A068VD50_COFCA	5E-101	Coffea canephora DH200=94 genomic scaffold, scaffold_249 {ECO:0000313\|EMBL:CDP18517.1}
TAIR10	AT3G06040.3	2E-35	Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000104	gene	1177492	1178082	+
GWHAAZE00000104	mRNA	1177492	1178082	+
GWHAAZE00000104	exon	1177492	1178082	+
GWHAAZE00000104	CDS	1177492	1178082	+

Transcript Sequence
>GWHTAAZE033539 ATGCATAAGAGCATGAAGTCCTTTGCACTTCTTAGATCCATTCAGTCCTGTCCGGTTCTCACTAAAATATCAGGACCTTTGCAATTCCGTACATTTCAACCTGATTTTGTACCCAGAGATCCCAAGGCCAAACCCAAAAGGTACAAGTACCCCGCGTTCTATGACCCGTACGGCCCTAGACCCCCACCATCAGATAAGATCGTTAAACTAGCTGAGCAAATCGCTGCCCTGCCACCTGAAGAACGTAGTCAGATCGGTCCCACTCTAAGAGAGAGAACTAGGCACCCCAAAATGCAGCCAATTTCAGTAGAAGGGATGGATGTGGGGGGAGGGGCAGGTGCGGGGTCCACACAGGCAGAGGAGAAGGCGGCAGAGAAAACGGCGTTTGATGTAAAGTTGGAGAAGTTTGACGCGGCTGCAAAAATAAAGGTGATAAAAGAGGTAAGGGCGTTTACAAATCTGGGATTGAAGGAAGCGAAAGAGCTGGTGGAGAAGGTGCCTGTTGTACTTAAACAAGGGATAACCAAAGAGGAGGCTAGCAGCATAATAGACAAGATAAAGGGTGCTGGTGGTGTTGCTGTGATGGAGTGA

Network for GWHGAAZE033500

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00542.20	Ribosomal_L12	129	192	9.10E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02935	RP-L7, MRPL12, rplL	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.962
	SRR3591706	second leaf	7.716
	SRR3591707	mature leaf	6.074
	SRR3591708	Shoot apex	11.312
	SRR3591709	Stem	4.091
	SRR3591710	White floral bud	8.023
	SRR3591711	White flower	21.868
	SRR3591712	Green floral bud	10.280
	SRR3591713	Yellow flower	15.493
SRP173429	SRR8316895	Juvenile bud stage	6.653
	SRR8316896	Juvenile bud stage	9.759
	SRR8316897	Juvenile bud stage	4.499
	SRR8316894	Third green stage	3.701
	SRR8316900	Third green stage	12.288
	SRR8316901	Third green stage	10.874
	SRR8316898	Complete white stage	2.759
	SRR8316899	Complete white stage	9.149
	SRR8316903	Complete white stage	5.962
	SRR8316902	Silver flowering stage	6.302
	SRR8316904	Silver flowering stage	6.348
	SRR8316905	Silver flowering stage	3.130
	SRR8316906	Gold flowering stage	12.454
	SRR8316907	Gold flowering stage	11.919
	SRR8316908	Gold flowering stage	8.130
SRP132670	SRR6706286	Control	13.324
	SRR6706287	Light intensity 50%	12.986
	SRR6706288	Light intensity 20%	13.795
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.273
	CNS0095593	Slightly white alabastrum(diploid) 2	9.429
	CNS0095594	Slightly white alabastrum(diploid) 3	14.878
	CNS0095595	Whole white alabastrum(diploid) 2	9.135
	CNS0095596	Whole white alabastrum(diploid) 3	11.303
	CNS0095597	Whole white alabastrum(diploid) 4	7.669
	CNS0095598	Silvery flower (diploied) 1	8.548
	CNS0095599	Silvery flower (diploied) 2	7.120
	CNS0095600	Silvery flower (diploied) 3	9.187
	CNS0095601	Golden flower (diploid) 1	9.016
	CNS0095602	Golden flower (diploid) 2	8.113
	CNS0095603	Golden flower (diploid) 3	9.544
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.859
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.058
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.589
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.597
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.807
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.097
	CNS0095610	Silvery flower (tetraploid) 1	8.571
	CNS0095611	Silvery flower (tetraploid) 2	9.522
	CNS0095612	Silvery flower (tetraploid) 3	6.060
	CNS0095613	Golden flower (tetraploid) 1	7.106
	CNS0095614	Golden flower (tetraploid) 2	9.785
	CNS0095615	Golden flower (tetraploid) 3	4.226
CRA001975	CRR073297	Stem 1	6.845
	CRR073298	Stem 2	6.923
	CRR073299	Stem 3	8.665
	CRR073300	Leaf 1	6.321
	CRR073301	Leaf 2	7.338
	CRR073302	Leaf 3	7.201
	CRR073303	Juvenile bud 1	6.239
	CRR073304	Juvenile bud 2	7.984
	CRR073305	Juvenile bud 3	7.559
	CRR073306	Third green 1	2.751
	CRR073307	Third green 2	1.998
	CRR073308	Third green 3	1.432
	CRR073309	Second white 1	12.248
	CRR073310	Second white 2	7.360
	CRR073311	Second white 3	6.853
	CRR073312	Silver flowering 1	6.188
	CRR073313	Silver flowering 2	9.508
	CRR073314	Silver flowering 3	6.466
	CRR073315	Gold flowering 1	6.215
	CRR073316	Gold flowering 2	7.876
	CRR073317	Gold flowering 3	4.819
	CRR073318	Tawny withering 1	3.466
	CRR073319	Tawny withering 2	3.853
	CRR073320	Tawny withering 3	4.419