Gene detail

Detail information of GWHGAAZE033468

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009787725.1	1.45054E-64	PREDICTED: proteasome subunit beta type-4-like [Nicotiana sylvestris]
Swissprot	tr\|Q7DLR9\|PSB4_ARATH	3E-62	Proteasome subunit beta type-4 (Precursor)
trEMBL	tr\|K4DA71\|K4DA71_SOLLC	9E-65	Proteasome subunit beta type {ECO:0000256\|RuleBase:RU004203}
TAIR10	AT1G56450.1	2E-50	20S proteasome beta subunit G1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000104	gene	274337	274779	+
GWHAAZE00000104	mRNA	274337	274779	+
GWHAAZE00000104	exon	274337	274489	+
GWHAAZE00000104	exon	274570	274779	+
GWHAAZE00000104	CDS	274337	274489	+
GWHAAZE00000104	CDS	274570	274779	+

Transcript Sequence
>GWHTAAZE033507 ATGTGTGGGATATATGATGGAAATTCCTTGGGCCCTAAAGAGGTCCACAACTATTTAACTCGTATGATGTACAACCGTTGCAACAAATTCGACCCTTTGTGGAATTCACTTGTACTTAGTGGAGTGAAAAATGGACAGAAGTATCTTGGAACGGTTAGTATGATCGGTGTACATTATGAGGACAATCATGTTGCCACTGGATTTGGAAATCACCTTGGGCTGCCAATTTTCCGTGATGAATGGCACAATAACATGAGTTTCGAGGATGGTGTTAAGTTATTAGAGAAACGCATGCGTGTTCTTCTATATCGGGATAGGTCTGCCATCAACAAGCTTCAGGTATGCATGTGCCTCTCGTCTTAG

Network for GWHGAAZE033468

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	26	116	2.20E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02736	PSMB4	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.765
	SRR3591706	second leaf	0.572
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.842
	SRR3591709	Stem	0.874
	SRR3591710	White floral bud	2.651
	SRR3591711	White flower	4.461
	SRR3591712	Green floral bud	1.637
	SRR3591713	Yellow flower	4.817
SRP173429	SRR8316895	Juvenile bud stage	0.667
	SRR8316896	Juvenile bud stage	1.641
	SRR8316897	Juvenile bud stage	1.509
	SRR8316894	Third green stage	0.474
	SRR8316900	Third green stage	1.236
	SRR8316901	Third green stage	2.260
	SRR8316898	Complete white stage	0.995
	SRR8316899	Complete white stage	3.329
	SRR8316903	Complete white stage	1.811
	SRR8316902	Silver flowering stage	0.777
	SRR8316904	Silver flowering stage	1.607
	SRR8316905	Silver flowering stage	0.631
	SRR8316906	Gold flowering stage	2.519
	SRR8316907	Gold flowering stage	1.935
	SRR8316908	Gold flowering stage	1.908
SRP132670	SRR6706286	Control	0.729
	SRR6706287	Light intensity 50%	0.911
	SRR6706288	Light intensity 20%	0.884
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.285
	CNS0095593	Slightly white alabastrum(diploid) 2	1.855
	CNS0095594	Slightly white alabastrum(diploid) 3	1.200
	CNS0095595	Whole white alabastrum(diploid) 2	1.428
	CNS0095596	Whole white alabastrum(diploid) 3	1.753
	CNS0095597	Whole white alabastrum(diploid) 4	1.797
	CNS0095598	Silvery flower (diploied) 1	2.806
	CNS0095599	Silvery flower (diploied) 2	1.455
	CNS0095600	Silvery flower (diploied) 3	3.083
	CNS0095601	Golden flower (diploid) 1	2.099
	CNS0095602	Golden flower (diploid) 2	2.100
	CNS0095603	Golden flower (diploid) 3	2.127
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.287
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.880
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.716
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.705
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.346
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.408
	CNS0095610	Silvery flower (tetraploid) 1	7.713
	CNS0095611	Silvery flower (tetraploid) 2	3.865
	CNS0095612	Silvery flower (tetraploid) 3	3.178
	CNS0095613	Golden flower (tetraploid) 1	7.602
	CNS0095614	Golden flower (tetraploid) 2	7.619
	CNS0095615	Golden flower (tetraploid) 3	4.229
CRA001975	CRR073297	Stem 1	0.746
	CRR073298	Stem 2	0.980
	CRR073299	Stem 3	1.105
	CRR073300	Leaf 1	0.992
	CRR073301	Leaf 2	1.178
	CRR073302	Leaf 3	1.059
	CRR073303	Juvenile bud 1	0.700
	CRR073304	Juvenile bud 2	1.523
	CRR073305	Juvenile bud 3	1.053
	CRR073306	Third green 1	0.698
	CRR073307	Third green 2	0.428
	CRR073308	Third green 3	0.613
	CRR073309	Second white 1	1.835
	CRR073310	Second white 2	1.196
	CRR073311	Second white 3	0.913
	CRR073312	Silver flowering 1	0.061
	CRR073313	Silver flowering 2	0.795
	CRR073314	Silver flowering 3	0.856
	CRR073315	Gold flowering 1	1.088
	CRR073316	Gold flowering 2	1.417
	CRR073317	Gold flowering 3	0.940
	CRR073318	Tawny withering 1	0.982
	CRR073319	Tawny withering 2	1.697
	CRR073320	Tawny withering 3	1.549