Gene detail

Detail information of GWHGAAZE033397

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI33335.3	1.00452E-69	unnamed protein product [Vitis vinifera]
COG	YP_006257988.1	7E-31	hydroxyethylthiazole kinase
Swissprot	tr\|Q9LIQ4\|THIM_ARATH	9E-63	Hydroxyethylthiazole kinase
trEMBL	tr\|F6HS46\|F6HS46_VITVI	5E-70	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB57505.1}
TAIR10	AT3G24030.1	4E-46	hydroxyethylthiazole kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000093	gene	343652	348721	-
GWHAAZE00000093	mRNA	343652	348721	-
GWHAAZE00000093	exon	348544	348721	-
GWHAAZE00000093	exon	348389	348471	-
GWHAAZE00000093	exon	343652	344044	-
GWHAAZE00000093	CDS	348544	348721	-
GWHAAZE00000093	CDS	348389	348471	-
GWHAAZE00000093	CDS	343652	344044	-

Transcript Sequence
>GWHTAAZE033436 ATGGACCCTACTATCCACGTTGTGCCAACGATCACCGTTAATCCAAAGCATCACCAACTTCGTGTCAATGGATCTGATGGCCAACACCCTCTTATCCGCGGGTGCATCGCCGGCCATGGTCCACTCTCTACAGGAAATCCCGGAGTTCACCTCTCTGACCCACGCGCTCTGCTTGAACCCTTGAGTACTGGACCCGGTTGCCGCCGGGGATTCCCGTTCCGGTTGAAGGCTTGTCTGGAGCTTGTTGGGCTGAAGCCTAGGGGTGTGGATAGCTCGCGTGAATCCACCGATGCAGTCGAAGCAGCAAAATCGTTAGCCAAATCGAGCGGCAGTATAGGTGCAGTATCAGGGGCCGTTGACATTGTAACAGACGGCGATCGAGTACTTGGTGCACAAAACGGGGTACCTATGATGCAAAAGATCACAGCCACCGGATGCTCGGTAACAGCCCTCATTGTGGCCTTTGTTGCCGTTGACCTGTTACATGCCTTTGAAGCCACTGTTATAGCATTGTCGATATTTGGTGTTGCTGGTGAGATAGGAATGGAAATGGCTAATGGGCCCGCTTCATTGCGGATGCACTTGATCGATTCACTTTACGGGCTGGATGAGGCTACCGTTCTTGAACGCATTAAAATCACCCGGCTGTCATGA

Network for GWHGAAZE033397

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02110.16	HK	84	203	2.40E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00878	thiM	Metabolic pathways	map01100
K00878	thiM	Thiamine metabolism	map00730

Gene Ontology

GO term	Ontology	Name
GO:0009228	biological_process	thiamine biosynthetic process
GO:0004417	molecular_function	hydroxyethylthiazole kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.421
	SRR3591706	second leaf	5.123
	SRR3591707	mature leaf	4.552
	SRR3591708	Shoot apex	8.084
	SRR3591709	Stem	8.521
	SRR3591710	White floral bud	1.551
	SRR3591711	White flower	2.349
	SRR3591712	Green floral bud	3.853
	SRR3591713	Yellow flower	2.123
SRP173429	SRR8316895	Juvenile bud stage	3.780
	SRR8316896	Juvenile bud stage	3.669
	SRR8316897	Juvenile bud stage	0.863
	SRR8316894	Third green stage	1.648
	SRR8316900	Third green stage	4.016
	SRR8316901	Third green stage	3.783
	SRR8316898	Complete white stage	0.931
	SRR8316899	Complete white stage	3.585
	SRR8316903	Complete white stage	1.566
	SRR8316902	Silver flowering stage	1.384
	SRR8316904	Silver flowering stage	1.396
	SRR8316905	Silver flowering stage	0.699
	SRR8316906	Gold flowering stage	2.980
	SRR8316907	Gold flowering stage	1.697
	SRR8316908	Gold flowering stage	2.296
SRP132670	SRR6706286	Control	3.601
	SRR6706287	Light intensity 50%	4.097
	SRR6706288	Light intensity 20%	5.015
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.317
	CNS0095593	Slightly white alabastrum(diploid) 2	3.254
	CNS0095594	Slightly white alabastrum(diploid) 3	5.003
	CNS0095595	Whole white alabastrum(diploid) 2	4.685
	CNS0095596	Whole white alabastrum(diploid) 3	4.911
	CNS0095597	Whole white alabastrum(diploid) 4	2.587
	CNS0095598	Silvery flower (diploied) 1	5.334
	CNS0095599	Silvery flower (diploied) 2	4.563
	CNS0095600	Silvery flower (diploied) 3	5.058
	CNS0095601	Golden flower (diploid) 1	4.933
	CNS0095602	Golden flower (diploid) 2	4.120
	CNS0095603	Golden flower (diploid) 3	3.824
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.032
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.830
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.998
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.823
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.937
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.294
	CNS0095610	Silvery flower (tetraploid) 1	3.870
	CNS0095611	Silvery flower (tetraploid) 2	3.886
	CNS0095612	Silvery flower (tetraploid) 3	2.011
	CNS0095613	Golden flower (tetraploid) 1	2.356
	CNS0095614	Golden flower (tetraploid) 2	2.822
	CNS0095615	Golden flower (tetraploid) 3	2.102
CRA001975	CRR073297	Stem 1	5.008
	CRR073298	Stem 2	6.126
	CRR073299	Stem 3	5.503
	CRR073300	Leaf 1	6.509
	CRR073301	Leaf 2	4.193
	CRR073302	Leaf 3	5.141
	CRR073303	Juvenile bud 1	4.011
	CRR073304	Juvenile bud 2	1.249
	CRR073305	Juvenile bud 3	1.901
	CRR073306	Third green 1	1.263
	CRR073307	Third green 2	0.447
	CRR073308	Third green 3	0.707
	CRR073309	Second white 1	0.199
	CRR073310	Second white 2	0.744
	CRR073311	Second white 3	0.679
	CRR073312	Silver flowering 1	1.433
	CRR073313	Silver flowering 2	0.162
	CRR073314	Silver flowering 3	0.207
	CRR073315	Gold flowering 1	3.179
	CRR073316	Gold flowering 2	2.811
	CRR073317	Gold flowering 3	1.786
	CRR073318	Tawny withering 1	3.116
	CRR073319	Tawny withering 2	1.112
	CRR073320	Tawny withering 3	1.932