Gene detail

Detail information of GWHGAAZE033303

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007031686.1	1.98525E-20	CCT motif family protein, putative [Theobroma cacao]
Swissprot	tr\|Q9C9A9\|COL7_ARATH	6E-21	Zinc finger protein CONSTANS-LIKE 7
trEMBL	tr\|A0A061EDX3\|A0A061EDX3_THECC	7E-21	CCT motif family protein, putative {ECO:0000313\|EMBL:EOY02612.1}
TAIR10	AT1G73870.1	4E-17	B-box type zinc finger protein with CCT domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	4467953	4471120	+
GWHAAZE00000094	mRNA	4467953	4471120	+
GWHAAZE00000094	exon	4467953	4468034	+
GWHAAZE00000094	exon	4470546	4470809	+
GWHAAZE00000094	exon	4470914	4471120	+
GWHAAZE00000094	five_prime_UTR	4467953	4468034	+
GWHAAZE00000094	five_prime_UTR	4470546	4470581	+
GWHAAZE00000094	CDS	4470582	4470809	+
GWHAAZE00000094	CDS	4470914	4470937	+
GWHAAZE00000094	three_prime_UTR	4470938	4471120	+

Transcript Sequence
>GWHTAAZE033342 AGGCCCACTTTACATCCACGCGGACTCTCCTCAAACTGTTCCTGATCTTCAAGATGATCTCCTAGACCATGATAATAACAATGGGACAAGGCAATTAGGGTTGTGGGCAGTACCAGAAATGAGTGGAGGAAGTAATAGCAGCAGGAGCAGCAGCATTAAACTGATAAAAGACGAAGAACATTTAGCAGTAAACGGCGGCGAAGGAGGAGGAGAAGAGTGGAAAAAGTTGGGGAATAGAGAGGCGAGCGTATTGAGATACAAAGAGAAGAGACGTAATCGCCTCTTCGCCAAAAAGATACGTTATGAAGTTCGTAAGCTCAATGCCGAGAAGCGCCCTCGCATTAAGGGGAGGTTTGTTAAGAGAAGTTGAGAGAGCTACAAATGAGCTTTTCAAATATATTGGAAATGGCAAAATGCACTCCGCTTTGGTGTTATTATATAGAAATAATGTACACTTTGTACAGGTTTTTGTAATGTTTTTGATTTTTCATCTTCTTTTTGCAAAAGGTTATAATACTAAAATGGAGTGTATTTAATTGTACCCTTTACTTTC

Network for GWHGAAZE033303

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06203.15	CCT	40	82	1.90E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.000
	SRR3591706	second leaf	39.528
	SRR3591707	mature leaf	24.239
	SRR3591708	Shoot apex	42.794
	SRR3591709	Stem	32.408
	SRR3591710	White floral bud	4.465
	SRR3591711	White flower	10.866
	SRR3591712	Green floral bud	1.900
	SRR3591713	Yellow flower	0.892
SRP173429	SRR8316895	Juvenile bud stage	5.975
	SRR8316896	Juvenile bud stage	3.612
	SRR8316897	Juvenile bud stage	2.432
	SRR8316894	Third green stage	1.595
	SRR8316900	Third green stage	1.867
	SRR8316901	Third green stage	1.776
	SRR8316898	Complete white stage	0.113
	SRR8316899	Complete white stage	3.132
	SRR8316903	Complete white stage	2.668
	SRR8316902	Silver flowering stage	0.254
	SRR8316904	Silver flowering stage	0.381
	SRR8316905	Silver flowering stage	0.260
	SRR8316906	Gold flowering stage	0.171
	SRR8316907	Gold flowering stage	0.452
	SRR8316908	Gold flowering stage	0.028
SRP132670	SRR6706286	Control	2.109
	SRR6706287	Light intensity 50%	2.411
	SRR6706288	Light intensity 20%	1.619
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.443
	CNS0095593	Slightly white alabastrum(diploid) 2	7.812
	CNS0095594	Slightly white alabastrum(diploid) 3	5.770
	CNS0095595	Whole white alabastrum(diploid) 2	4.644
	CNS0095596	Whole white alabastrum(diploid) 3	1.919
	CNS0095597	Whole white alabastrum(diploid) 4	3.163
	CNS0095598	Silvery flower (diploied) 1	30.960
	CNS0095599	Silvery flower (diploied) 2	15.025
	CNS0095600	Silvery flower (diploied) 3	3.361
	CNS0095601	Golden flower (diploid) 1	25.305
	CNS0095602	Golden flower (diploid) 2	10.076
	CNS0095603	Golden flower (diploid) 3	9.156
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.436
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.129
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.650
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.532
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.596
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.517
	CNS0095610	Silvery flower (tetraploid) 1	1.288
	CNS0095611	Silvery flower (tetraploid) 2	3.032
	CNS0095612	Silvery flower (tetraploid) 3	1.507
	CNS0095613	Golden flower (tetraploid) 1	0.351
	CNS0095614	Golden flower (tetraploid) 2	3.833
	CNS0095615	Golden flower (tetraploid) 3	0.981
CRA001975	CRR073297	Stem 1	6.650
	CRR073298	Stem 2	4.998
	CRR073299	Stem 3	4.179
	CRR073300	Leaf 1	1.711
	CRR073301	Leaf 2	2.771
	CRR073302	Leaf 3	1.013
	CRR073303	Juvenile bud 1	1.088
	CRR073304	Juvenile bud 2	0.574
	CRR073305	Juvenile bud 3	1.653
	CRR073306	Third green 1	0.210
	CRR073307	Third green 2	0.403
	CRR073308	Third green 3	0.225
	CRR073309	Second white 1	0.117
	CRR073310	Second white 2	0.081
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.127
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	6.678
	CRR073316	Gold flowering 2	8.017
	CRR073317	Gold flowering 3	4.389
	CRR073318	Tawny withering 1	10.131
	CRR073319	Tawny withering 2	8.150
	CRR073320	Tawny withering 3	8.971