Gene detail

Detail information of GWHGAAZE033256

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002277200.1	5.45498E-81	PREDICTED: probable monodehydroascorbate reductase, cytoplasmic isoform 2 [Vitis vinifera]
Swissprot	tr\|Q9LK94\|MDAR2_ARATH	8E-58	Probable monodehydroascorbate reductase, cytoplasmic isoform 2
trEMBL	tr\|A5BNW8\|A5BNW8_VITVI	2E-81	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN77104.1}
TAIR10	AT3G27820.1	4E-49	monodehydroascorbate reductase 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	3656399	3656851	-
GWHAAZE00000094	mRNA	3656399	3656851	-
GWHAAZE00000094	exon	3656399	3656851	-
GWHAAZE00000094	CDS	3656399	3656851	-

Transcript Sequence
>GWHTAAZE033295 ATGGAACCCAACAAGACTGGGGAGTTTGACTACCTCCCATTCTTCTATTCGAGAGTCTTTACATTGTCTTGGCAGTTTTATGGGGAAAATGTTGGGGAAGTGGTTCATTTTGGGGATTTCTCGGGTACTACTTTTGGGGCTTATTGGGTGAGTAAAGGTCATCTAGTTGGGTCATTTCTTGAAGGTGGAACCAAAGAGGAGTATACCACAATAGCAACGGCCACAAGGCTCCAACCTACAATTGAAGACTTGGGCGAGCTCGAGAGACAGGGTCTTGGGTTTGCTCTGACCGTGAGCCAAAAGCCAGTGCCGGTCCAGTTACTTGATGTTAGCGGTTCAAGCCTTGTTGTGCAGAAACCAATATACGTGTGGCATGCAACTGCTGGTGTTATTGTGGCTGCATCAATAGCTGCATTTGCATATTGGTATGGAAGGAGGCGCCGAAGGTGGTGA

Network for GWHGAAZE033256

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08232	E1.6.5.4	Metabolic pathways	map01100
K08232	E1.6.5.4	Ascorbate and aldarate metabolism	map00053

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity
GO:0050660	molecular_function	flavin adenine dinucleotide binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.981
	SRR3591706	second leaf	93.106
	SRR3591707	mature leaf	82.659
	SRR3591708	Shoot apex	44.402
	SRR3591709	Stem	46.771
	SRR3591710	White floral bud	47.931
	SRR3591711	White flower	41.159
	SRR3591712	Green floral bud	52.937
	SRR3591713	Yellow flower	35.497
SRP173429	SRR8316895	Juvenile bud stage	20.393
	SRR8316896	Juvenile bud stage	39.360
	SRR8316897	Juvenile bud stage	14.525
	SRR8316894	Third green stage	15.486
	SRR8316900	Third green stage	37.713
	SRR8316901	Third green stage	40.538
	SRR8316898	Complete white stage	36.788
	SRR8316899	Complete white stage	46.253
	SRR8316903	Complete white stage	57.667
	SRR8316902	Silver flowering stage	19.098
	SRR8316904	Silver flowering stage	22.899
	SRR8316905	Silver flowering stage	11.405
	SRR8316906	Gold flowering stage	33.107
	SRR8316907	Gold flowering stage	46.878
	SRR8316908	Gold flowering stage	36.641
SRP132670	SRR6706286	Control	35.998
	SRR6706287	Light intensity 50%	35.423
	SRR6706288	Light intensity 20%	36.055
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	41.606
	CNS0095593	Slightly white alabastrum(diploid) 2	41.394
	CNS0095594	Slightly white alabastrum(diploid) 3	34.346
	CNS0095595	Whole white alabastrum(diploid) 2	31.216
	CNS0095596	Whole white alabastrum(diploid) 3	26.968
	CNS0095597	Whole white alabastrum(diploid) 4	32.909
	CNS0095598	Silvery flower (diploied) 1	48.254
	CNS0095599	Silvery flower (diploied) 2	37.904
	CNS0095600	Silvery flower (diploied) 3	38.576
	CNS0095601	Golden flower (diploid) 1	42.469
	CNS0095602	Golden flower (diploid) 2	40.747
	CNS0095603	Golden flower (diploid) 3	38.724
	CNS0095604	Slightly white alabastrum(tetraploid) 1	30.152
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.121
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.480
	CNS0095607	Whole white alabastrum(tetraploid) 1	27.148
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.430
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.025
	CNS0095610	Silvery flower (tetraploid) 1	48.436
	CNS0095611	Silvery flower (tetraploid) 2	33.943
	CNS0095612	Silvery flower (tetraploid) 3	75.193
	CNS0095613	Golden flower (tetraploid) 1	39.125
	CNS0095614	Golden flower (tetraploid) 2	35.946
	CNS0095615	Golden flower (tetraploid) 3	23.001
CRA001975	CRR073297	Stem 1	36.106
	CRR073298	Stem 2	29.103
	CRR073299	Stem 3	24.291
	CRR073300	Leaf 1	30.218
	CRR073301	Leaf 2	37.705
	CRR073302	Leaf 3	21.824
	CRR073303	Juvenile bud 1	25.341
	CRR073304	Juvenile bud 2	84.769
	CRR073305	Juvenile bud 3	29.583
	CRR073306	Third green 1	22.828
	CRR073307	Third green 2	26.598
	CRR073308	Third green 3	20.516
	CRR073309	Second white 1	19.421
	CRR073310	Second white 2	17.327
	CRR073311	Second white 3	13.930
	CRR073312	Silver flowering 1	21.399
	CRR073313	Silver flowering 2	17.509
	CRR073314	Silver flowering 3	23.022
	CRR073315	Gold flowering 1	91.979
	CRR073316	Gold flowering 2	98.764
	CRR073317	Gold flowering 3	49.519
	CRR073318	Tawny withering 1	29.680
	CRR073319	Tawny withering 2	34.429
	CRR073320	Tawny withering 3	26.201