Gene detail

Detail information of GWHGAAZE033042

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP18793.1	6.22681E-54	unnamed protein product [Coffea canephora]
COG	YP_004180201.1	0.0000001	serine/threonine protein kinase
Swissprot	tr\|Q0V7T5\|Y1864_ARATH	8E-39	Probable receptor-like protein kinase At1g80640 (Precursor)
trEMBL	tr\|A0A068VGI3\|A0A068VGI3_COFCA	2E-54	Coffea canephora DH200=94 genomic scaffold, scaffold_288 {ECO:0000313\|EMBL:CDP18793.1}
TAIR10	AT5G11020.1	6E-36	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000087	gene	47661	48002	-
GWHAAZE00000087	mRNA	47661	48002	-
GWHAAZE00000087	exon	47661	48002	-
GWHAAZE00000087	CDS	47661	48002	-

Transcript Sequence
>GWHTAAZE033081 ATGCACTGGGGATTTGGATGTGTATACAAGGCTCAGTTGGAAGAGAATTTACATGCTGCTGTAAAGAGACTAGTTGATGGAAGTGTGTCCGCCATTACAGAATTTGAGAATGAGGTGCATTTGTTGGGTAAAATGCAGCATCCGAATATAATTTCTTCGTTAGGTTATAGCATTCATGGAGAAACTAGGCTTCTTGTTTATGAATTGATTGAGAATGGATCTCTTGAATCTCAATTGCACGGACCTTCTGATGGATCAGCTTTACCATGGCATATCAGGATGAAAATAGCTCTTGATATAGCAAGAGGATTAGAATATTTGCACGAGCACTGCAGCCCACAA

Network for GWHGAAZE033042

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	5	110	2.80E-17

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-X

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.830
	SRR3591706	second leaf	3.190
	SRR3591707	mature leaf	3.628
	SRR3591708	Shoot apex	4.509
	SRR3591709	Stem	3.407
	SRR3591710	White floral bud	0.097
	SRR3591711	White flower	0.428
	SRR3591712	Green floral bud	0.459
	SRR3591713	Yellow flower	0.233
SRP173429	SRR8316895	Juvenile bud stage	2.208
	SRR8316896	Juvenile bud stage	2.473
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	2.950
	SRR8316900	Third green stage	4.954
	SRR8316901	Third green stage	6.358
	SRR8316898	Complete white stage	2.794
	SRR8316899	Complete white stage	7.936
	SRR8316903	Complete white stage	5.538
	SRR8316902	Silver flowering stage	1.983
	SRR8316904	Silver flowering stage	6.430
	SRR8316905	Silver flowering stage	1.072
	SRR8316906	Gold flowering stage	6.461
	SRR8316907	Gold flowering stage	5.573
	SRR8316908	Gold flowering stage	1.521
SRP132670	SRR6706286	Control	0.524
	SRR6706287	Light intensity 50%	0.440
	SRR6706288	Light intensity 20%	0.339
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.328
	CNS0095593	Slightly white alabastrum(diploid) 2	5.456
	CNS0095594	Slightly white alabastrum(diploid) 3	3.877
	CNS0095595	Whole white alabastrum(diploid) 2	7.236
	CNS0095596	Whole white alabastrum(diploid) 3	6.249
	CNS0095597	Whole white alabastrum(diploid) 4	10.547
	CNS0095598	Silvery flower (diploied) 1	2.320
	CNS0095599	Silvery flower (diploied) 2	2.327
	CNS0095600	Silvery flower (diploied) 3	11.033
	CNS0095601	Golden flower (diploid) 1	6.445
	CNS0095602	Golden flower (diploid) 2	6.031
	CNS0095603	Golden flower (diploid) 3	5.921
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.914
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.484
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.447
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.832
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.905
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.624
	CNS0095610	Silvery flower (tetraploid) 1	5.837
	CNS0095611	Silvery flower (tetraploid) 2	5.498
	CNS0095612	Silvery flower (tetraploid) 3	5.849
	CNS0095613	Golden flower (tetraploid) 1	6.257
	CNS0095614	Golden flower (tetraploid) 2	4.764
	CNS0095615	Golden flower (tetraploid) 3	7.015
CRA001975	CRR073297	Stem 1	2.084
	CRR073298	Stem 2	1.703
	CRR073299	Stem 3	0.564
	CRR073300	Leaf 1	1.784
	CRR073301	Leaf 2	1.256
	CRR073302	Leaf 3	0.743
	CRR073303	Juvenile bud 1	0.889
	CRR073304	Juvenile bud 2	0.121
	CRR073305	Juvenile bud 3	1.657
	CRR073306	Third green 1	0.326
	CRR073307	Third green 2	0.770
	CRR073308	Third green 3	0.993
	CRR073309	Second white 1	0.455
	CRR073310	Second white 2	0.575
	CRR073311	Second white 3	1.777
	CRR073312	Silver flowering 1	0.468
	CRR073313	Silver flowering 2	0.715
	CRR073314	Silver flowering 3	1.522
	CRR073315	Gold flowering 1	2.202
	CRR073316	Gold flowering 2	3.482
	CRR073317	Gold flowering 3	4.525
	CRR073318	Tawny withering 1	3.589
	CRR073319	Tawny withering 2	3.286
	CRR073320	Tawny withering 3	2.511