Gene detail

Detail information of GWHGAAZE032951

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004141048.1	5.01407E-72	PREDICTED: uncharacterized protein LOC101203477 [Cucumis sativus]
trEMBL	tr\|A0A0A0LIN6\|A0A0A0LIN6_CUCSA	2E-72	Uncharacterized protein {ECO:0000313\|EMBL:KGN60547.1}
TAIR10	AT4G29480.1	2E-53	Mitochondrial ATP synthase subunit G protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000071	gene	101401	104010	-
GWHAAZE00000071	mRNA	101401	104010	-
GWHAAZE00000071	exon	103829	104010	-
GWHAAZE00000071	exon	101401	101587	-
GWHAAZE00000071	CDS	103829	104010	-
GWHAAZE00000071	CDS	101401	101587	-

Transcript Sequence
>GWHTAAZE032990 ATGGCGTCAAAGCTGCATCAATTGCAATCAAAGGCTACTCAAGCGTCAAAGCTTGCTTCAAAACATGCGTCTTCCTATTACAAGCAGCTACTAGAGAAGAACAAGCAATACATTCAAGAACCACCTACTGTGGAGAAATGCCAGCTCCTGTCAAACCAGCTCTTCTACACTCGTCTTGCCAGTTTACCTGGTCGCTATGAGTCATTCTGGAAGGAAGTTGATTATGTGAGGCAACTGTGGAAAAAAAGGCAGGAGCTAAAAATCGAGGATGCAGGAATTGCTGCTCTTTTCGGTCTTGAATGCTTTGCCTGGTTTTGTGCTGGAGAGATTGTAGGACGAGGTTTTACCATCACTGGTTACCATGTTTAA

Network for GWHGAAZE032951

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04718.16	ATP-synt_G	16	121	2.00E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02140	ATPeFG, ATP5L, ATP20	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.937
	SRR3591706	second leaf	3.427
	SRR3591707	mature leaf	2.268
	SRR3591708	Shoot apex	8.496
	SRR3591709	Stem	5.670
	SRR3591710	White floral bud	2.631
	SRR3591711	White flower	7.550
	SRR3591712	Green floral bud	6.964
	SRR3591713	Yellow flower	3.930
SRP173429	SRR8316895	Juvenile bud stage	8.213
	SRR8316896	Juvenile bud stage	13.828
	SRR8316897	Juvenile bud stage	1.095
	SRR8316894	Third green stage	4.037
	SRR8316900	Third green stage	9.862
	SRR8316901	Third green stage	7.226
	SRR8316898	Complete white stage	2.239
	SRR8316899	Complete white stage	7.593
	SRR8316903	Complete white stage	4.182
	SRR8316902	Silver flowering stage	2.880
	SRR8316904	Silver flowering stage	3.210
	SRR8316905	Silver flowering stage	1.391
	SRR8316906	Gold flowering stage	6.424
	SRR8316907	Gold flowering stage	6.953
	SRR8316908	Gold flowering stage	5.615
SRP132670	SRR6706286	Control	8.904
	SRR6706287	Light intensity 50%	9.224
	SRR6706288	Light intensity 20%	10.789
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.473
	CNS0095593	Slightly white alabastrum(diploid) 2	13.025
	CNS0095594	Slightly white alabastrum(diploid) 3	15.879
	CNS0095595	Whole white alabastrum(diploid) 2	12.771
	CNS0095596	Whole white alabastrum(diploid) 3	12.570
	CNS0095597	Whole white alabastrum(diploid) 4	8.836
	CNS0095598	Silvery flower (diploied) 1	8.944
	CNS0095599	Silvery flower (diploied) 2	8.452
	CNS0095600	Silvery flower (diploied) 3	9.858
	CNS0095601	Golden flower (diploid) 1	10.015
	CNS0095602	Golden flower (diploid) 2	6.730
	CNS0095603	Golden flower (diploid) 3	8.819
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.370
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.340
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.865
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.405
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.459
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.597
	CNS0095610	Silvery flower (tetraploid) 1	5.699
	CNS0095611	Silvery flower (tetraploid) 2	7.103
	CNS0095612	Silvery flower (tetraploid) 3	3.867
	CNS0095613	Golden flower (tetraploid) 1	3.470
	CNS0095614	Golden flower (tetraploid) 2	4.602
	CNS0095615	Golden flower (tetraploid) 3	2.637
CRA001975	CRR073297	Stem 1	16.480
	CRR073298	Stem 2	16.573
	CRR073299	Stem 3	16.364
	CRR073300	Leaf 1	12.085
	CRR073301	Leaf 2	10.791
	CRR073302	Leaf 3	13.107
	CRR073303	Juvenile bud 1	10.566
	CRR073304	Juvenile bud 2	6.487
	CRR073305	Juvenile bud 3	7.932
	CRR073306	Third green 1	0.749
	CRR073307	Third green 2	0.822
	CRR073308	Third green 3	3.883
	CRR073309	Second white 1	4.996
	CRR073310	Second white 2	2.839
	CRR073311	Second white 3	3.399
	CRR073312	Silver flowering 1	1.870
	CRR073313	Silver flowering 2	3.131
	CRR073314	Silver flowering 3	0.786
	CRR073315	Gold flowering 1	8.412
	CRR073316	Gold flowering 2	4.721
	CRR073317	Gold flowering 3	9.708
	CRR073318	Tawny withering 1	13.590
	CRR073319	Tawny withering 2	14.920
	CRR073320	Tawny withering 3	12.447