Gene detail

Detail information of GWHGAAZE032814

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009354064.1	4.50148E-33	PREDICTED: receptor-like protein kinase FERONIA [Pyrus x bretschneideri]
Swissprot	tr\|Q9SCZ4\|FERON_ARATH	1E-31	Receptor-like protein kinase FERONIA (Precursor)
trEMBL	tr\|A0A061EFQ7\|A0A061EFQ7_THECC	2E-33	Malectin/receptor protein kinase family protein isoform 2 {ECO:0000313\|EMBL:EOY03721.1}
TAIR10	AT3G51550.1	4E-21	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000050	gene	49964	50618	+
GWHAAZE00000050	mRNA	49964	50618	+
GWHAAZE00000050	exon	49964	50166	+
GWHAAZE00000050	exon	50303	50618	+
GWHAAZE00000050	CDS	49964	50166	+
GWHAAZE00000050	CDS	50303	50618	+

Transcript Sequence
>GWHTAAZE032853 ATGCCGGGCCGCCCCCTGCAACGTCCGCCACTGCCTAACGATCAGATCCACCTACGTGCCATAGGAGTCAAAGTCAACCAGAGACTCTCAAATACTAAACTAGAATTTGCCATGCCATTCTATCTCGCATTAACAAATCCTTTTGATCCAGCATCATCAATCAATACAGACCAGCATGTTGCTTTATCCAGGATTTACCTCAGAGACAAGTTAACCTCCCCGGCAGATCAATATTGCCGTCGGTTTACATTTGCCGAGATCCGAGCAGCCACTCGCAACTTTTCCCATGGATTTGTTATCGGAAAAGGCGGATTTGGTAAGGTTTTCAAAGGTATCCTCGGCAATGGAGCTACTACGGTTGCTATAAAGCGATTGGATCCCATGTCCAAACAAGGGGGTAAGGAATTTACAACTGAGATAGAAATGCTTTCTAAAATTCGACATAGCCATGTTGTTTCTCTTCTTGGTTACTGCAATGACAATGATGAAATGATCCATGGAAAATGGAAGCTTGGCTGA

Network for GWHGAAZE032814

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	99	164	1.40E-11

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.574
	SRR8316896	Juvenile bud stage	4.013
	SRR8316897	Juvenile bud stage	0.779
	SRR8316894	Third green stage	1.855
	SRR8316900	Third green stage	1.310
	SRR8316901	Third green stage	1.018
	SRR8316898	Complete white stage	0.917
	SRR8316899	Complete white stage	1.448
	SRR8316903	Complete white stage	2.881
	SRR8316902	Silver flowering stage	2.652
	SRR8316904	Silver flowering stage	5.192
	SRR8316905	Silver flowering stage	2.821
	SRR8316906	Gold flowering stage	6.477
	SRR8316907	Gold flowering stage	5.129
	SRR8316908	Gold flowering stage	2.264
SRP132670	SRR6706286	Control	5.295
	SRR6706287	Light intensity 50%	5.181
	SRR6706288	Light intensity 20%	4.887
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.164
	CNS0095593	Slightly white alabastrum(diploid) 2	0.816
	CNS0095594	Slightly white alabastrum(diploid) 3	0.757
	CNS0095595	Whole white alabastrum(diploid) 2	1.043
	CNS0095596	Whole white alabastrum(diploid) 3	0.564
	CNS0095597	Whole white alabastrum(diploid) 4	1.025
	CNS0095598	Silvery flower (diploied) 1	5.499
	CNS0095599	Silvery flower (diploied) 2	3.273
	CNS0095600	Silvery flower (diploied) 3	1.039
	CNS0095601	Golden flower (diploid) 1	1.220
	CNS0095602	Golden flower (diploid) 2	4.320
	CNS0095603	Golden flower (diploid) 3	3.062
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.564
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.204
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.264
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.353
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.522
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.452
	CNS0095610	Silvery flower (tetraploid) 1	0.393
	CNS0095611	Silvery flower (tetraploid) 2	0.690
	CNS0095612	Silvery flower (tetraploid) 3	0.752
	CNS0095613	Golden flower (tetraploid) 1	0.183
	CNS0095614	Golden flower (tetraploid) 2	0.584
	CNS0095615	Golden flower (tetraploid) 3	0.662
CRA001975	CRR073297	Stem 1	2.793
	CRR073298	Stem 2	1.529
	CRR073299	Stem 3	0.405
	CRR073300	Leaf 1	2.691
	CRR073301	Leaf 2	3.226
	CRR073302	Leaf 3	0.072
	CRR073303	Juvenile bud 1	0.226
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.695
	CRR073306	Third green 1	0.594
	CRR073307	Third green 2	0.052
	CRR073308	Third green 3	0.316
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.759
	CRR073311	Second white 3	0.138
	CRR073312	Silver flowering 1	0.885
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.441
	CRR073316	Gold flowering 2	0.648
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.677
	CRR073319	Tawny withering 2	0.648
	CRR073320	Tawny withering 3	0.513