Gene detail

Detail information of GWHGAAZE032374

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006344627.1	4.95944E-27	PREDICTED: DNA polymerase zeta catalytic subunit-like isoform X1 [Solanum tuberosum]
Swissprot	tr\|Q766Z3\|REV3_ARATH	1E-23	DNA polymerase zeta catalytic subunit
trEMBL	tr\|K4B0V9\|K4B0V9_SOLLC	2E-27	DNA polymerase {ECO:0000256\|RuleBase:RU000442}
TAIR10	AT1G67500.1	2E-21	recovery protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000020	gene	236633	238718	+
GWHAAZE00000020	mRNA	236633	238718	+
GWHAAZE00000020	exon	236633	236690	+
GWHAAZE00000020	exon	236963	237012	+
GWHAAZE00000020	exon	237108	237274	+
GWHAAZE00000020	exon	237351	237375	+
GWHAAZE00000020	exon	238620	238718	+
GWHAAZE00000020	CDS	236633	236690	+
GWHAAZE00000020	CDS	236963	237012	+
GWHAAZE00000020	CDS	237108	237274	+
GWHAAZE00000020	CDS	237351	237375	+
GWHAAZE00000020	CDS	238620	238718	+

Transcript Sequence
>GWHTAAZE032412 GTATTACCTTATTTATATGTTCCATGTTCGGATCTATTGCTTCAACCAGATCAAGAAAGTGATGTATGTACAAATGTTTTATCTCTTGCTATTGAGAAAGCTTTGAAGAGTTATTGGTTGAAACTCTTACAGCTTAAAGGCAATGCTGGTTCAAAACATCAGCATGTTCATGATTGCAGTCTTGTCCGAGCAAAGAAATTTTATGGCTATCATTCATTGGAAGAGCTATTTGCAAAAATATACCTTTATCCGCTTCCACACTTCTGTTTTATGGTAACTTATGAAGTCTTAAACAATGAGGTACAACGCAGAGCCCTTGACAAAAATTTAAGGTATTATCCACAGGATGTCTCTCGCTGCAAATCCTCTTCTGGTACACATTCTCGAGCCTCCTGTTAG

Network for GWHGAAZE032374

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02350	REV3L, POLZ	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.530
	SRR3591706	second leaf	0.840
	SRR3591707	mature leaf	2.206
	SRR3591708	Shoot apex	2.564
	SRR3591709	Stem	2.284
	SRR3591710	White floral bud	3.248
	SRR3591711	White flower	2.546
	SRR3591712	Green floral bud	3.309
	SRR3591713	Yellow flower	1.333
SRP173429	SRR8316895	Juvenile bud stage	2.254
	SRR8316896	Juvenile bud stage	1.542
	SRR8316897	Juvenile bud stage	0.586
	SRR8316894	Third green stage	0.289
	SRR8316900	Third green stage	0.549
	SRR8316901	Third green stage	1.402
	SRR8316898	Complete white stage	0.251
	SRR8316899	Complete white stage	1.187
	SRR8316903	Complete white stage	0.682
	SRR8316902	Silver flowering stage	0.014
	SRR8316904	Silver flowering stage	0.017
	SRR8316905	Silver flowering stage	0.014
	SRR8316906	Gold flowering stage	0.345
	SRR8316907	Gold flowering stage	0.626
	SRR8316908	Gold flowering stage	0.583
SRP132670	SRR6706286	Control	0.333
	SRR6706287	Light intensity 50%	0.160
	SRR6706288	Light intensity 20%	0.410
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.733
	CNS0095593	Slightly white alabastrum(diploid) 2	1.999
	CNS0095594	Slightly white alabastrum(diploid) 3	3.036
	CNS0095595	Whole white alabastrum(diploid) 2	1.446
	CNS0095596	Whole white alabastrum(diploid) 3	3.211
	CNS0095597	Whole white alabastrum(diploid) 4	0.639
	CNS0095598	Silvery flower (diploied) 1	0.972
	CNS0095599	Silvery flower (diploied) 2	0.314
	CNS0095600	Silvery flower (diploied) 3	0.355
	CNS0095601	Golden flower (diploid) 1	0.651
	CNS0095602	Golden flower (diploid) 2	0.714
	CNS0095603	Golden flower (diploid) 3	0.680
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.077
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.069
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.011
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.140
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.033
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.008
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.039
CRA001975	CRR073297	Stem 1	0.277
	CRR073298	Stem 2	0.550
	CRR073299	Stem 3	0.041
	CRR073300	Leaf 1	0.478
	CRR073301	Leaf 2	0.636
	CRR073302	Leaf 3	0.114
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.366
	CRR073306	Third green 1	0.053
	CRR073307	Third green 2	0.329
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	1.212
	CRR073310	Second white 2	0.329
	CRR073311	Second white 3	0.151
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.459
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.519
	CRR073316	Gold flowering 2	0.143
	CRR073317	Gold flowering 3	0.283
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.326
	CRR073320	Tawny withering 3	0.009