Gene detail

Detail information of GWHGAAZE032367

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009769956.1	7.67772E-67	PREDICTED: uracil-DNA glycosylase isoform X1 [Nicotiana sylvestris]
COG	YP_002798558.1	6E-34	uracil-DNA glycosylase
Swissprot	tr\|Q06327\|LOX1_ARATH	1E-23	Linoleate 9S-lipoxygenase 1
trEMBL	tr\|M1BR91\|M1BR91_SOLTU	6E-64	Uracil-DNA glycosylase {ECO:0000256\|HAMAP-Rule:MF_03166, ECO:0000256\|RuleBase:RU003780}
TAIR10	AT3G18630.1	2E-47	uracil dna glycosylase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000020	gene	156946	158138	+
GWHAAZE00000020	mRNA	156946	158138	+
GWHAAZE00000020	exon	156946	157071	+
GWHAAZE00000020	exon	157316	157423	+
GWHAAZE00000020	exon	157621	157896	+
GWHAAZE00000020	exon	157983	158138	+
GWHAAZE00000020	CDS	156946	157071	+
GWHAAZE00000020	CDS	157316	157423	+
GWHAAZE00000020	CDS	157621	157896	+
GWHAAZE00000020	CDS	157983	158138	+

Transcript Sequence
>GWHTAAZE032405 ATGTTAGTTTATTCGTTTAACTTTGATGTTCTTGAATCAGAGGATGAGACAGCGTGGAGTTCTGACGAAGAATTTGCAAGAGAAATGCTGGCCGGAATAAACCTTGTTGTTATTCGTCGTCTCCGAGAGTTCCCTCCAATGAGCAAGCTAGATCCCAAACTCTACGACAACCAAAACAGCTCAATAACCAAAGAACACATAAAGGATAACTTAGATGGTCTAACCATAGAAAAGCTATTGGTGGAGGAGATGTGGTTGGAAGCACTTCCGGGGGAACTCCATAAGCCCTATGCAAAGAAGTTGTGCAACTTCGTTGAAAGTGAAATAAGAGGTGGCTGTGATGGTATTGGAGTTCCAATTTATCCGCCCCCGCATTTGATCTTCAATGCACTTAACACTACATCATTTGACAGGGTCAAAGCTATCATCATCAGGCAGGATCCGTATCATGGGCCTGGTCAAGCAATGGGCCTCTCTTCTCTGTACCAGAAGGCATTAAAATACCTTAAAGGTGTTCTATTGCTCAATGATTTTCTTACTGTTAGGCAGCATCAGGCAAATTCTCACGTAAAGAAGGGGTGGGAACAATTTACCGATGCTGTCATTGAGACAATTTCAAAGAAGAAAAAAGGAGTAGTGTTTCTTCTCTGGGGAAATTACGCTTAA

Network for GWHGAAZE032367

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	7	82	2.50E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03648	UNG, UDG	Base excision repair	map03410

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.111
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.223
	SRR3591709	Stem	0.178
	SRR3591710	White floral bud	0.048
	SRR3591711	White flower	0.355
	SRR3591712	Green floral bud	0.086
	SRR3591713	Yellow flower	0.117
SRP173429	SRR8316895	Juvenile bud stage	0.036
	SRR8316896	Juvenile bud stage	0.281
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.280
	SRR8316901	Third green stage	0.127
	SRR8316898	Complete white stage	0.027
	SRR8316899	Complete white stage	0.228
	SRR8316903	Complete white stage	0.095
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.181
	SRR8316905	Silver flowering stage	0.027
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.017
	SRR6706287	Light intensity 50%	0.017
	SRR6706288	Light intensity 20%	0.038
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.203
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.019
	CNS0095595	Whole white alabastrum(diploid) 2	0.059
	CNS0095596	Whole white alabastrum(diploid) 3	0.054
	CNS0095597	Whole white alabastrum(diploid) 4	0.119
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.064
	CNS0095600	Silvery flower (diploied) 3	0.247
	CNS0095601	Golden flower (diploid) 1	0.022
	CNS0095602	Golden flower (diploid) 2	0.226
	CNS0095603	Golden flower (diploid) 3	0.019
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.114
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.133
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.352
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.033
	CNS0095610	Silvery flower (tetraploid) 1	0.156
	CNS0095611	Silvery flower (tetraploid) 2	0.070
	CNS0095612	Silvery flower (tetraploid) 3	0.223
	CNS0095613	Golden flower (tetraploid) 1	0.274
	CNS0095614	Golden flower (tetraploid) 2	0.232
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.070
	CRR073298	Stem 2	0.161
	CRR073299	Stem 3	0.094
	CRR073300	Leaf 1	0.050
	CRR073301	Leaf 2	0.253
	CRR073302	Leaf 3	0.048
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.092
	CRR073305	Juvenile bud 3	0.198
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.040
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.011
	CRR073316	Gold flowering 2	0.094
	CRR073317	Gold flowering 3	0.020
	CRR073318	Tawny withering 1	0.071
	CRR073319	Tawny withering 2	0.066
	CRR073320	Tawny withering 3	0.063