Gene detail

Detail information of GWHGAAZE032190

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KGN61070.1	1.86292E-20	hypothetical protein Csa_2G036680 [Cucumis sativus]
Swissprot	tr\|O24575\|DCAM_MAIZE	1E-18	S-adenosylmethionine decarboxylase beta chain (Precursor)
trEMBL	tr\|A0A0A0LGN6\|A0A0A0LGN6_CUCSA	7E-21	Uncharacterized protein {ECO:0000313\|EMBL:KGN61070.1}
TAIR10	AT5G18930.1	4E-15	Adenosylmethionine decarboxylase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	72372959	72373440	-
GWHAAZE00000009	mRNA	72372959	72373440	-
GWHAAZE00000009	exon	72372959	72373047	-
GWHAAZE00000009	exon	72373290	72373440	-
GWHAAZE00000009	CDS	72373290	72373440	-
GWHAAZE00000009	CDS	72372959	72373047	-

Transcript Sequence
>GWHTAAZE032228 ATGACGAAAATGTCCAAGATAAATGAGATACTTCTGTGTCTTGAGATTTGTGACTTTGAGTTTGACCCGTGCGGGTACTCTGTGAATGGGATTGAAGGTGCACCATATTCTACGGTGCACGTGACCCCAGAGGATGGGTTTAACTATGCCATGAACACACCCTCCAAGTACGTGATGAATAATTGCTGGAAGGAGATGGCAGAGGAGGTGAATGACGTGGCAATTGGTAATGCAAATGCG

Network for GWHGAAZE032190

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01536.17	SAM_decarbox	1	51	1.60E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01611	speD, AMD1	Metabolic pathways	map01100
		Cysteine and methionine metabolism	map00270
		Arginine and proline metabolism	map00330

Gene Ontology

GO term	Ontology	Name
GO:0006597	biological_process	spermine biosynthetic process
GO:0008295	biological_process	spermidine biosynthetic process
GO:0004014	molecular_function	adenosylmethionine decarboxylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description
SRP075780	SRR3591705	youngest leaf
	SRR3591706	second leaf
	SRR3591707	mature leaf
	SRR3591708	Shoot apex
	SRR3591709	Stem
	SRR3591710	White floral bud
	SRR3591711	White flower
	SRR3591712	Green floral bud
	SRR3591713	Yellow flower
SRP173429	SRR8316895	Juvenile bud stage
	SRR8316896	Juvenile bud stage
	SRR8316897	Juvenile bud stage
	SRR8316894	Third green stage
	SRR8316900	Third green stage
	SRR8316901	Third green stage
	SRR8316898	Complete white stage
	SRR8316899	Complete white stage
	SRR8316903	Complete white stage
	SRR8316902	Silver flowering stage
	SRR8316904	Silver flowering stage
	SRR8316905	Silver flowering stage
	SRR8316906	Gold flowering stage
	SRR8316907	Gold flowering stage
	SRR8316908	Gold flowering stage
SRP132670	SRR6706286	Control
	SRR6706287	Light intensity 50%
	SRR6706288	Light intensity 20%
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1
	CNS0095593	Slightly white alabastrum(diploid) 2
	CNS0095594	Slightly white alabastrum(diploid) 3
	CNS0095595	Whole white alabastrum(diploid) 2
	CNS0095596	Whole white alabastrum(diploid) 3
	CNS0095597	Whole white alabastrum(diploid) 4
	CNS0095598	Silvery flower (diploied) 1
	CNS0095599	Silvery flower (diploied) 2
	CNS0095600	Silvery flower (diploied) 3
	CNS0095601	Golden flower (diploid) 1
	CNS0095602	Golden flower (diploid) 2
	CNS0095603	Golden flower (diploid) 3
	CNS0095604	Slightly white alabastrum(tetraploid) 1
	CNS0095605	Slightly white alabastrum(tetraploid) 2
	CNS0095606	Slightly white alabastrum(tetraploid) 3
	CNS0095607	Whole white alabastrum(tetraploid) 1
	CNS0095608	Whole white alabastrum(tetraploid) 2
	CNS0095609	Whole white alabastrum(tetraploid) 3
	CNS0095610	Silvery flower (tetraploid) 1
	CNS0095611	Silvery flower (tetraploid) 2
	CNS0095612	Silvery flower (tetraploid) 3
	CNS0095613	Golden flower (tetraploid) 1
	CNS0095614	Golden flower (tetraploid) 2
	CNS0095615	Golden flower (tetraploid) 3
CRA001975	CRR073297	Stem 1
	CRR073298	Stem 2
	CRR073299	Stem 3
	CRR073300	Leaf 1
	CRR073301	Leaf 2
	CRR073302	Leaf 3
	CRR073303	Juvenile bud 1
	CRR073304	Juvenile bud 2
	CRR073305	Juvenile bud 3
	CRR073306	Third green 1
	CRR073307	Third green 2
	CRR073308	Third green 3
	CRR073309	Second white 1
	CRR073310	Second white 2
	CRR073311	Second white 3
	CRR073312	Silver flowering 1
	CRR073313	Silver flowering 2
	CRR073314	Silver flowering 3
	CRR073315	Gold flowering 1
	CRR073316	Gold flowering 2
	CRR073317	Gold flowering 3
	CRR073318	Tawny withering 1
	CRR073319	Tawny withering 2
	CRR073320	Tawny withering 3