Gene detail

Detail information of GWHGAAZE032132

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI25622.3	2.24008E-56	unnamed protein product [Vitis vinifera]
COG	YP_007146068.1	1E-10	chitinase
trEMBL	tr\|D7T540\|D7T540_VITVI	8E-57	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI25622.3}
TAIR10	AT4G19800.1	1E-16	Glycosyl hydrolase family protein with chitinase insertion domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	71172701	71173324	+
GWHAAZE00000009	mRNA	71172701	71173324	+
GWHAAZE00000009	exon	71172701	71173324	+
GWHAAZE00000009	CDS	71172701	71173324	+

Transcript Sequence
>GWHTAAZE032170 ATGGGAAACTTTATAACCACCCTCCACGTGAAAAGATCAAAACTGAAAGCTCTCGTATCCATTGGGGGAGGCACTTATCGCGATAATCGTGTTGCCTTAATAAAATCTGCTGTCAGTGTTGCCAGACAACATGGTTTTGATGGCCTTAACTTGGACTGGGAATTCCTAAACACTCTTTTAGAAATGTTTAACCTTGTAACCCTCTTCGCCGAATGGTGGGACAGTGTCAACAAGGAGTCCCTTGGCTCAGGCAAGCCTCCTTTACTTTTGTCCGCGGCTGTCTATTTCTCTTTCATTTTTCTCTTATCTAACACCCCGCGGACTTACCCAGGGGATGCCATAAAAAATTACCTTGATTTTGTCAGCCCAATGTGCTTTGATTACCACGGGGCTTGGGACACATCGACCACGGGTGCTCATGCATTGTTCTATGACAATTCTAGCAATGTGAGCATAAGCCTTGGGATTTTTTCCATGGATAAAGAATGGTGTGCCATCAAAGAAGCTAGTGATGGGGGTGCCAATGTATGGCAAAACATGGGAGTTCAAGGAGGTGAGCGAGCACGGGATCGGAGCTCCAGCAGTGGGGATTGGCTAGGGAAAGAGTGGGGTATTGGTGTATAG

Network for GWHGAAZE032132

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00704.29	Glyco_hydro_18	6	152	8.60E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01183	E3.2.1.14	Metabolic pathways	map01100
K01183	E3.2.1.14	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0008061	molecular_function	chitin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.151
	SRR3591706	second leaf	0.581
	SRR3591707	mature leaf	0.939
	SRR3591708	Shoot apex	1.800
	SRR3591709	Stem	2.602
	SRR3591710	White floral bud	0.517
	SRR3591711	White flower	1.601
	SRR3591712	Green floral bud	1.006
	SRR3591713	Yellow flower	4.071
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.406
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.284
	SRR8316901	Third green stage	0.174
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.389
	SRR8316903	Complete white stage	0.123
	SRR8316902	Silver flowering stage	0.057
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.155
SRP132670	SRR6706286	Control	0.221
	SRR6706287	Light intensity 50%	0.094
	SRR6706288	Light intensity 20%	0.174
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.218
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.161
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.278
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.066
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.110
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.256
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.129
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000