Gene detail

Detail information of GWHGAAZE032109

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002267523.1	2.36851E-97	PREDICTED: 40S ribosomal protein S11 [Vitis vinifera]
COG	YP_002428859.1	5E-30	30S ribosomal protein S17P
Swissprot	tr\|P16181\|RS111_ARATH	4E-95	40S ribosomal protein S11-1
trEMBL	tr\|D7T503\|D7T503_VITVI	9E-98	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI25585.3}
TAIR10	AT3G48930.1	1E-68	Nucleic acid-binding, OB-fold-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	70676362	70679640	+
GWHAAZE00000009	mRNA	70676362	70679640	+
GWHAAZE00000009	exon	70676362	70676373	+
GWHAAZE00000009	exon	70676518	70676558	+
GWHAAZE00000009	exon	70676682	70676782	+
GWHAAZE00000009	exon	70678328	70678472	+
GWHAAZE00000009	exon	70678982	70679071	+
GWHAAZE00000009	exon	70679547	70679640	+
GWHAAZE00000009	CDS	70676362	70676373	+
GWHAAZE00000009	CDS	70676518	70676558	+
GWHAAZE00000009	CDS	70676682	70676782	+
GWHAAZE00000009	CDS	70678328	70678472	+
GWHAAZE00000009	CDS	70678982	70679071	+
GWHAAZE00000009	CDS	70679547	70679640	+

Transcript Sequence
>GWHTAAZE032147 ATGGCTGAGCAGACGGAGAAGGCATTTCTGAAGCAGCCTAAAGTGTTTCTAAGCTCGAAGAAATCTGGGAAAGGAAAGAGGCCTGGAAAAGGTGGAAACCGCTTCTATAAGAGCGTTGGTCTTGGATTTAAGACTCCAAGAGAAGCCATTGAAGGAACTTATATTGATAAGAAATGCCCCTTCACCGGGAATGTTTCGATCAGAGGCCGTATCATAGCTGGCACATGCCACAGTGCAAAAATGGTGAGGACCATCATTGTTCGACGGAATTATCTTCATTACGTCAAGAAGTATCAAAGATATGAGAAGAGGCACTCAAACATTCCCGCACACGTATCACCATGCTTCCGTGTGAAGGAAGGAGACCATATTATTGTTGGTCAATGCAGACCTTTGTCTAAGACGGTTAGGTTCAACGTTTTGAAAGTGGTACCTGCTGGATCTTCTGGAGGTGGTGGAAAGAAGGCTTTTACCGGCATGTGA

Network for GWHGAAZE032109

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16205.6	Ribosomal_S17_N	4	72	5.80E-32
PF00366.21	Ribosomal_S17	74	142	1.30E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02949	RP-S11e, RPS11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	415.245
	SRR3591706	second leaf	133.968
	SRR3591707	mature leaf	44.827
	SRR3591708	Shoot apex	418.186
	SRR3591709	Stem	152.400
	SRR3591710	White floral bud	140.534
	SRR3591711	White flower	154.311
	SRR3591712	Green floral bud	315.118
	SRR3591713	Yellow flower	110.472
SRP173429	SRR8316895	Juvenile bud stage	177.403
	SRR8316896	Juvenile bud stage	259.319
	SRR8316897	Juvenile bud stage	170.702
	SRR8316894	Third green stage	125.360
	SRR8316900	Third green stage	403.789
	SRR8316901	Third green stage	370.534
	SRR8316898	Complete white stage	63.072
	SRR8316899	Complete white stage	305.981
	SRR8316903	Complete white stage	105.475
	SRR8316902	Silver flowering stage	61.381
	SRR8316904	Silver flowering stage	65.065
	SRR8316905	Silver flowering stage	33.355
	SRR8316906	Gold flowering stage	91.717
	SRR8316907	Gold flowering stage	100.894
	SRR8316908	Gold flowering stage	152.684
SRP132670	SRR6706286	Control	293.217
	SRR6706287	Light intensity 50%	314.974
	SRR6706288	Light intensity 20%	376.724
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	280.175
	CNS0095593	Slightly white alabastrum(diploid) 2	340.102
	CNS0095594	Slightly white alabastrum(diploid) 3	266.177
	CNS0095595	Whole white alabastrum(diploid) 2	298.249
	CNS0095596	Whole white alabastrum(diploid) 3	352.892
	CNS0095597	Whole white alabastrum(diploid) 4	243.757
	CNS0095598	Silvery flower (diploied) 1	105.365
	CNS0095599	Silvery flower (diploied) 2	100.695
	CNS0095600	Silvery flower (diploied) 3	77.398
	CNS0095601	Golden flower (diploid) 1	70.379
	CNS0095602	Golden flower (diploid) 2	60.655
	CNS0095603	Golden flower (diploid) 3	66.786
	CNS0095604	Slightly white alabastrum(tetraploid) 1	283.973
	CNS0095605	Slightly white alabastrum(tetraploid) 2	264.651
	CNS0095606	Slightly white alabastrum(tetraploid) 3	279.195
	CNS0095607	Whole white alabastrum(tetraploid) 1	180.305
	CNS0095608	Whole white alabastrum(tetraploid) 2	169.351
	CNS0095609	Whole white alabastrum(tetraploid) 3	253.730
	CNS0095610	Silvery flower (tetraploid) 1	69.755
	CNS0095611	Silvery flower (tetraploid) 2	61.421
	CNS0095612	Silvery flower (tetraploid) 3	58.277
	CNS0095613	Golden flower (tetraploid) 1	48.661
	CNS0095614	Golden flower (tetraploid) 2	53.796
	CNS0095615	Golden flower (tetraploid) 3	44.276
CRA001975	CRR073297	Stem 1	263.546
	CRR073298	Stem 2	261.894
	CRR073299	Stem 3	263.018
	CRR073300	Leaf 1	307.311
	CRR073301	Leaf 2	304.217
	CRR073302	Leaf 3	422.170
	CRR073303	Juvenile bud 1	369.733
	CRR073304	Juvenile bud 2	289.293
	CRR073305	Juvenile bud 3	245.494
	CRR073306	Third green 1	60.086
	CRR073307	Third green 2	69.652
	CRR073308	Third green 3	68.774
	CRR073309	Second white 1	74.674
	CRR073310	Second white 2	45.789
	CRR073311	Second white 3	38.476
	CRR073312	Silver flowering 1	66.586
	CRR073313	Silver flowering 2	82.632
	CRR073314	Silver flowering 3	51.510
	CRR073315	Gold flowering 1	100.960
	CRR073316	Gold flowering 2	102.662
	CRR073317	Gold flowering 3	93.738
	CRR073318	Tawny withering 1	194.093
	CRR073319	Tawny withering 2	200.873
	CRR073320	Tawny withering 3	220.099