Gene detail

Detail information of GWHGAAZE032059

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009620036.1	2.2683E-138	PREDICTED: 40S ribosomal protein S5 [Nicotiana tomentosiformis]
COG	YP_001013746.1	2E-62	30S ribosomal protein S7P
Swissprot	tr\|P51427\|RS52_ARATH	2E-125	40S ribosomal protein S5-2
trEMBL	tr\|K4D831\|K4D831_SOLLC	5E-135	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc11g042610.1.1}
TAIR10	AT3G11940.2	4E-99	ribosomal protein 5A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	69968093	69970648	+
GWHAAZE00000009	mRNA	69968093	69970648	+
GWHAAZE00000009	exon	69968093	69968176	+
GWHAAZE00000009	exon	69969893	69970164	+
GWHAAZE00000009	exon	69970286	69970489	+
GWHAAZE00000009	exon	69970594	69970648	+
GWHAAZE00000009	CDS	69968093	69968176	+
GWHAAZE00000009	CDS	69969893	69970164	+
GWHAAZE00000009	CDS	69970286	69970489	+
GWHAAZE00000009	CDS	69970594	69970648	+

Transcript Sequence
>GWHTAAZE032097 ATGGCGGCGGCTGTTGTAGCTACGGAGCAGAATCAAAAGCCTGCTGTGATGCTCTTCAATCGATGGTCTTACGACGAAGTTCAGGTGAGTGACCTTTCTGTTGAGGATTACATCACTGCAACTGCTGCCAAGCACCCGACTTATATTCCTCACACAGCTGGGAGGTACCAAGCCAAGAGGTTTAGGAAGGCACAGTGCCCCATTGTTGAGAGGCTTACCAACTCTCTTATGATGCATGGGCGCAACAATGGGAAGAAGCTGATGGCAGTCCGCATCGTTAAGCATGCCATGGAAATTATCCATTTGCTCACTGACTTGAACCCAATTCAAGTCATTGTTGATGCAGTTATCAACAGTGGGCCACGAGAAGATGCAACTCGTATCGGATCTGCTGGTGTTGTGAGGCGTCAGGCCGTTGATATTTCGCCACTGAGACGTGTTAACCAAGCCATATATCTCCTCACAACCGGTGCTCGCGAGAGTGCTTTCAGGAACATCAAGACCATAGCCGAGTGCCTTGCTGATGAGCTTATCAATGCTGCCAAGGGTTCTTCCAACAGCTACGCTATTAAGAAGAAAGATGAAATTGAGAGGGTAGCCAAGGCCAATCGTTGA

Network for GWHGAAZE032059

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00177.22	Ribosomal_S7	59	204	2.50E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02989	RP-S5e, RPS5	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	414.131
	SRR3591706	second leaf	190.370
	SRR3591707	mature leaf	74.984
	SRR3591708	Shoot apex	531.183
	SRR3591709	Stem	149.869
	SRR3591710	White floral bud	175.373
	SRR3591711	White flower	205.926
	SRR3591712	Green floral bud	462.577
	SRR3591713	Yellow flower	185.557
SRP173429	SRR8316895	Juvenile bud stage	197.227
	SRR8316896	Juvenile bud stage	283.889
	SRR8316897	Juvenile bud stage	164.178
	SRR8316894	Third green stage	123.456
	SRR8316900	Third green stage	436.580
	SRR8316901	Third green stage	407.945
	SRR8316898	Complete white stage	70.006
	SRR8316899	Complete white stage	340.941
	SRR8316903	Complete white stage	85.665
	SRR8316902	Silver flowering stage	66.460
	SRR8316904	Silver flowering stage	69.749
	SRR8316905	Silver flowering stage	32.238
	SRR8316906	Gold flowering stage	105.521
	SRR8316907	Gold flowering stage	107.267
	SRR8316908	Gold flowering stage	146.870
SRP132670	SRR6706286	Control	411.678
	SRR6706287	Light intensity 50%	429.002
	SRR6706288	Light intensity 20%	485.232
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	378.366
	CNS0095593	Slightly white alabastrum(diploid) 2	429.301
	CNS0095594	Slightly white alabastrum(diploid) 3	345.825
	CNS0095595	Whole white alabastrum(diploid) 2	328.547
	CNS0095596	Whole white alabastrum(diploid) 3	405.833
	CNS0095597	Whole white alabastrum(diploid) 4	281.547
	CNS0095598	Silvery flower (diploied) 1	148.526
	CNS0095599	Silvery flower (diploied) 2	137.094
	CNS0095600	Silvery flower (diploied) 3	138.685
	CNS0095601	Golden flower (diploid) 1	119.861
	CNS0095602	Golden flower (diploid) 2	122.580
	CNS0095603	Golden flower (diploid) 3	126.048
	CNS0095604	Slightly white alabastrum(tetraploid) 1	392.517
	CNS0095605	Slightly white alabastrum(tetraploid) 2	377.294
	CNS0095606	Slightly white alabastrum(tetraploid) 3	407.848
	CNS0095607	Whole white alabastrum(tetraploid) 1	198.402
	CNS0095608	Whole white alabastrum(tetraploid) 2	204.616
	CNS0095609	Whole white alabastrum(tetraploid) 3	369.487
	CNS0095610	Silvery flower (tetraploid) 1	117.933
	CNS0095611	Silvery flower (tetraploid) 2	97.885
	CNS0095612	Silvery flower (tetraploid) 3	73.868
	CNS0095613	Golden flower (tetraploid) 1	73.693
	CNS0095614	Golden flower (tetraploid) 2	107.919
	CNS0095615	Golden flower (tetraploid) 3	73.994
CRA001975	CRR073297	Stem 1	491.019
	CRR073298	Stem 2	505.064
	CRR073299	Stem 3	655.077
	CRR073300	Leaf 1	557.737
	CRR073301	Leaf 2	610.643
	CRR073302	Leaf 3	780.009
	CRR073303	Juvenile bud 1	711.403
	CRR073304	Juvenile bud 2	586.005
	CRR073305	Juvenile bud 3	628.205
	CRR073306	Third green 1	87.661
	CRR073307	Third green 2	92.053
	CRR073308	Third green 3	109.434
	CRR073309	Second white 1	119.900
	CRR073310	Second white 2	81.112
	CRR073311	Second white 3	58.572
	CRR073312	Silver flowering 1	105.403
	CRR073313	Silver flowering 2	188.364
	CRR073314	Silver flowering 3	151.710
	CRR073315	Gold flowering 1	257.773
	CRR073316	Gold flowering 2	286.981
	CRR073317	Gold flowering 3	253.969
	CRR073318	Tawny withering 1	475.865
	CRR073319	Tawny withering 2	374.060
	CRR073320	Tawny withering 3	503.277