Gene detail

Detail information of GWHGAAZE031944

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP06209.1	4.51629E-31	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SCZ4\|FERON_ARATH	2E-28	Receptor-like protein kinase FERONIA (Precursor)
trEMBL	tr\|A0A068UDG6\|A0A068UDG6_COFCA	2E-31	Coffea canephora DH200=94 genomic scaffold, scaffold_20 {ECO:0000313\|EMBL:CDP06209.1}
TAIR10	AT3G51550.1	2E-25	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	67764219	67764584	-
GWHAAZE00000009	mRNA	67764219	67764584	-
GWHAAZE00000009	exon	67764219	67764584	-
GWHAAZE00000009	CDS	67764219	67764584	-

Transcript Sequence
>GWHTAAZE031982 TCTCGCAACTATTCCAATGGATTCGTCATCGAAAAAGGCATATTCGCAAAGGTATTCGAAGGGATAATTGACAATGAAACCACTACAGTTGCCATAAAGCAATGGGATCCCATATCGAAACAAGGGGGAATGGAATTCTCCACTGAGATAGAATTGCTTTCTAAGTTTCGACACACTCATGTTGTTTCTCTTATCGGTTATTGTGACCACAAAGACGAAATGATCATTGTTTATGAATATTTGGAAAATGGAAGCTTGGCCAATTATCTTTGCAAAGAAAAAGTAATAAACACTAAAAATTATAATATGTCATGGGTAAAACATGTTAGAGGTGTCTTGCATAGAGTTATACACCGCGATGTGTGA

Network for GWHGAAZE031944

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	10	111	4.10E-18

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.670
	SRR3591706	second leaf	0.537
	SRR3591707	mature leaf	0.955
	SRR3591708	Shoot apex	0.388
	SRR3591709	Stem	0.352
	SRR3591710	White floral bud	0.269
	SRR3591711	White flower	2.067
	SRR3591712	Green floral bud	0.470
	SRR3591713	Yellow flower	0.337
SRP173429	SRR8316895	Juvenile bud stage	0.733
	SRR8316896	Juvenile bud stage	0.542
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.281
	SRR8316900	Third green stage	0.036
	SRR8316901	Third green stage	0.279
	SRR8316898	Complete white stage	0.321
	SRR8316899	Complete white stage	1.655
	SRR8316903	Complete white stage	0.222
	SRR8316902	Silver flowering stage	0.263
	SRR8316904	Silver flowering stage	0.425
	SRR8316905	Silver flowering stage	0.161
	SRR8316906	Gold flowering stage	0.218
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.126
SRP132670	SRR6706286	Control	1.169
	SRR6706287	Light intensity 50%	1.143
	SRR6706288	Light intensity 20%	0.990
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.101
	CNS0095593	Slightly white alabastrum(diploid) 2	1.217
	CNS0095594	Slightly white alabastrum(diploid) 3	1.721
	CNS0095595	Whole white alabastrum(diploid) 2	1.139
	CNS0095596	Whole white alabastrum(diploid) 3	0.339
	CNS0095597	Whole white alabastrum(diploid) 4	0.687
	CNS0095598	Silvery flower (diploied) 1	2.289
	CNS0095599	Silvery flower (diploied) 2	1.744
	CNS0095600	Silvery flower (diploied) 3	1.709
	CNS0095601	Golden flower (diploid) 1	3.114
	CNS0095602	Golden flower (diploid) 2	3.674
	CNS0095603	Golden flower (diploid) 3	2.114
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.414
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.755
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.383
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.297
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.028
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.069
	CNS0095610	Silvery flower (tetraploid) 1	1.126
	CNS0095611	Silvery flower (tetraploid) 2	2.513
	CNS0095612	Silvery flower (tetraploid) 3	0.358
	CNS0095613	Golden flower (tetraploid) 1	0.151
	CNS0095614	Golden flower (tetraploid) 2	0.650
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.497
	CRR073298	Stem 2	0.283
	CRR073299	Stem 3	0.288
	CRR073300	Leaf 1	0.132
	CRR073301	Leaf 2	0.903
	CRR073302	Leaf 3	0.170
	CRR073303	Juvenile bud 1	0.313
	CRR073304	Juvenile bud 2	0.259
	CRR073305	Juvenile bud 3	0.168
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.143
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.553
	CRR073316	Gold flowering 2	0.103
	CRR073317	Gold flowering 3	2.546
	CRR073318	Tawny withering 1	1.219
	CRR073319	Tawny withering 2	2.420
	CRR073320	Tawny withering 3	1.590