Gene detail

Detail information of GWHGAAZE031934

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAT66935.1	1.87148E-73	superoxide dismutase [Malus baccata var. xiaojinensis]
COG	YP_003290884.1	8E-30	Superoxide dismutase
Swissprot	tr\|P93258\|SODC1_MESCR	2E-74	Superoxide dismutase [Cu-Zn] 1
trEMBL	tr\|Q6DTU3\|Q6DTU3_MALBX	7E-74	Superoxide dismutase [Cu-Zn] {ECO:0000256\|RuleBase:RU000393}
TAIR10	AT1G08830.2	1E-52	copper/zinc superoxide dismutase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	67607983	67609121	+
GWHAAZE00000009	mRNA	67607983	67609121	+
GWHAAZE00000009	exon	67607983	67608067	+
GWHAAZE00000009	exon	67608186	67608287	+
GWHAAZE00000009	exon	67608407	67608502	+
GWHAAZE00000009	exon	67608839	67608870	+
GWHAAZE00000009	exon	67608978	67609121	+
GWHAAZE00000009	CDS	67607983	67608067	+
GWHAAZE00000009	CDS	67608186	67608287	+
GWHAAZE00000009	CDS	67608407	67608502	+
GWHAAZE00000009	CDS	67608839	67608870	+
GWHAAZE00000009	CDS	67608978	67609121	+

Transcript Sequence
>GWHTAAZE031972 CACATAGCAATGTTGAAGGCTGTTGCAGTTCTTAGTGGCAATGTGGGTGTGAAAGGAACCGTCCACTTCATCCAAGAAGGAGATGGTCCAACTACTGTTACTGGAAACCTCACTGGCCTTAAGCCCGGGTTTCATGGCTTCCATGTACATGCCCTTGGGGACACAACAAATGGTTGCATGTCAACTGGACCTCATTTCAATCCTGCTGGCAAAGAACATGGTGCTCCTGAAGACGAGATTCGTCATGCTGGTGATCTTGGAAATGTTACTGCTGGTGATGATGGTACTGCTAAGTTCACAATTATTGACAAACAGATTCCTCTTGCTGGACCAAGTTCTATTGTTGGACGAGCTGTTGTTGTCCATGCGGATCCCGATGATCTTGGCAGAGGTAACATAACTCATTTATCAATTTTTTTTTTCTTTTTTCGTGTGAACTTTGGCTTACCGAAAAAATAG

Network for GWHGAAZE031934

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00080.21	Sod_Cu	16	128	8.00E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04565	SOD1	Peroxisome	map04146
K04565	SOD1	Longevity regulating pathway - multiple species	map04213

Gene Ontology

GO term	Ontology	Name
GO:0006801	biological_process	superoxide metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0046872	molecular_function	metal ion binding
GO:0004784	molecular_function	superoxide dismutase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.381
	SRR8316896	Juvenile bud stage	0.320
	SRR8316897	Juvenile bud stage	0.344
	SRR8316894	Third green stage	0.011
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.125
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.025
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.085
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	8.117
	CRR073298	Stem 2	1.677
	CRR073299	Stem 3	9.281
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.329
	CRR073320	Tawny withering 3	0.000