Gene detail

Detail information of GWHGAAZE031867

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011013002.1	6.0953E-123	PREDICTED: calcium and calcium/calmodulin-dependent serine/threonine-protein kinase-like [Populus euphratica]
COG	YP_003831303.1	5E-27	PASTA domain-containing Ser/Thr protein kinase
Swissprot	tr\|A0AAR7\|CCAMK_LOTJA	1E-120	Calcium and calcium/calmodulin-dependent serine/threonine-protein kinase
trEMBL	tr\|A0A067E5M4\|A0A067E5M4_CITSI	3E-123	Uncharacterized protein {ECO:0000313\|EMBL:KDO50378.1}
TAIR10	AT2G38910.1	1E-36	calcium-dependent protein kinase 20

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	66121574	66122260	+
GWHAAZE00000009	mRNA	66121574	66122260	+
GWHAAZE00000009	exon	66121574	66122260	+
GWHAAZE00000009	CDS	66121574	66122260	+

Transcript Sequence
>GWHTAAZE031905 ATGGGACAAGAAACAAGAACCCTTTCTGATGAATATGAAGTCACCGATATACTGGGAAGAGGAGGGTTTTCGGTTGTGAGAAAAGGGATAAAGAAAACCAGTGGGGGGAATGGCGAAGTAGCGATCAAAACATTAAGAAGGATAACTACTAATGGACCAATGACTTCATTCTCGTCAAACTGGAAACAAGTTTCAGTATCTGATGCATTACTCACGAATGAGATTTTGGTGATGAGAAGAATAGTTGAAGATGTATCTCCACATCCAAATGTGATCCATTTGTATGACGTGTGCGAGGATGCTAGCGGGGTCCACTTGATACTCGAGCTGTGCTCGGGTGGCGAGTTATTTGACCGGATTGTTAGGCAGGCAAGGTACTCGGAGGCCGAGGCTGCGGCTGTGATGAGGCAGATAGCTAGCGGGTTGAAGGCTCTGCATAGTGCAAATATTGTGCATAGGGATTTGAAGCCGGAGAATTGCCTTTTCTTGAATGAGAAGAAAGATTCTCCGTTGAAGATTATGGATTTTGGGTTGAGTTCTGTGGAGGAGTTTACTGATCCTGTTGTGGGGCTGTTCGGTTCCATTGATTATGTGTCCCCTGAGGCTCTTTTGCAGGGGACAGTTTCCTCGAGGAGTGATATGTGGTCTTTGGGGGTCATCTTGTACATCCTCCTCTCCGGGTACTAA

Network for GWHGAAZE031867

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	12	227	3.70E-47

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_CAMK1-DCAMKL

KEGG pathway

KO	Enzyme	pathway	mapID
K13412	CPK	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.527
	SRR3591706	second leaf	0.746
	SRR3591707	mature leaf	1.500
	SRR3591708	Shoot apex	1.784
	SRR3591709	Stem	7.747
	SRR3591710	White floral bud	3.851
	SRR3591711	White flower	0.154
	SRR3591712	Green floral bud	1.680
	SRR3591713	Yellow flower	1.279
SRP173429	SRR8316895	Juvenile bud stage	0.781
	SRR8316896	Juvenile bud stage	1.427
	SRR8316897	Juvenile bud stage	0.268
	SRR8316894	Third green stage	0.853
	SRR8316900	Third green stage	2.704
	SRR8316901	Third green stage	2.015
	SRR8316898	Complete white stage	0.171
	SRR8316899	Complete white stage	1.873
	SRR8316903	Complete white stage	0.506
	SRR8316902	Silver flowering stage	0.094
	SRR8316904	Silver flowering stage	1.301
	SRR8316905	Silver flowering stage	0.165
	SRR8316906	Gold flowering stage	0.728
	SRR8316907	Gold flowering stage	1.488
	SRR8316908	Gold flowering stage	0.884
SRP132670	SRR6706286	Control	1.557
	SRR6706287	Light intensity 50%	1.451
	SRR6706288	Light intensity 20%	1.539
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.631
	CNS0095593	Slightly white alabastrum(diploid) 2	0.471
	CNS0095594	Slightly white alabastrum(diploid) 3	0.530
	CNS0095595	Whole white alabastrum(diploid) 2	3.650
	CNS0095596	Whole white alabastrum(diploid) 3	3.906
	CNS0095597	Whole white alabastrum(diploid) 4	2.690
	CNS0095598	Silvery flower (diploied) 1	0.752
	CNS0095599	Silvery flower (diploied) 2	0.058
	CNS0095600	Silvery flower (diploied) 3	1.269
	CNS0095601	Golden flower (diploid) 1	0.310
	CNS0095602	Golden flower (diploid) 2	0.764
	CNS0095603	Golden flower (diploid) 3	0.991
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.733
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.769
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.584
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.616
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.409
	CNS0095610	Silvery flower (tetraploid) 1	1.522
	CNS0095611	Silvery flower (tetraploid) 2	2.040
	CNS0095612	Silvery flower (tetraploid) 3	0.851
	CNS0095613	Golden flower (tetraploid) 1	1.316
	CNS0095614	Golden flower (tetraploid) 2	1.306
	CNS0095615	Golden flower (tetraploid) 3	1.740
CRA001975	CRR073297	Stem 1	1.253
	CRR073298	Stem 2	1.346
	CRR073299	Stem 3	0.204
	CRR073300	Leaf 1	1.781
	CRR073301	Leaf 2	1.310
	CRR073302	Leaf 3	1.887
	CRR073303	Juvenile bud 1	2.368
	CRR073304	Juvenile bud 2	0.668
	CRR073305	Juvenile bud 3	1.508
	CRR073306	Third green 1	0.564
	CRR073307	Third green 2	0.542
	CRR073308	Third green 3	0.703
	CRR073309	Second white 1	0.257
	CRR073310	Second white 2	0.567
	CRR073311	Second white 3	0.355
	CRR073312	Silver flowering 1	0.766
	CRR073313	Silver flowering 2	0.119
	CRR073314	Silver flowering 3	0.080
	CRR073315	Gold flowering 1	0.208
	CRR073316	Gold flowering 2	0.666
	CRR073317	Gold flowering 3	0.558
	CRR073318	Tawny withering 1	3.327
	CRR073319	Tawny withering 2	1.347
	CRR073320	Tawny withering 3	2.433