Gene detail

Detail information of GWHGAAZE031761

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO83230.1	1.81738E-71	hypothetical protein CISIN_1g0067712mg, partial [Citrus sinensis]
Swissprot	tr\|Q5W9E7\|MUS81_ARATH	5E-61	Crossover junction endonuclease MUS81
trEMBL	tr\|A0A067GX41\|A0A067GX41_CITSI	7E-72	Uncharacterized protein {ECO:0000313\|EMBL:KDO83230.1} (Fragment)
TAIR10	AT4G30870.1	9E-53	Restriction endonuclease, type II-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	64567704	64570407	+
GWHAAZE00000009	mRNA	64567704	64570407	+
GWHAAZE00000009	exon	64567704	64567949	+
GWHAAZE00000009	exon	64569319	64569400	+
GWHAAZE00000009	exon	64569494	64569564	+
GWHAAZE00000009	exon	64570303	64570407	+
GWHAAZE00000009	CDS	64567704	64567949	+
GWHAAZE00000009	CDS	64569319	64569400	+
GWHAAZE00000009	CDS	64569494	64569564	+
GWHAAZE00000009	CDS	64570303	64570407	+

Transcript Sequence
>GWHTAAZE031799 ATGTGCAGTTGTTTCACGACCGAGATTTTGGAGGGCTTTGATGTGCAGAGAACAAGCGGATTAGGAGATACACTTAGGAAGTATGGTCATCTTACTCAAGCAATAACCCAATATTACAAATCTATGGATTATGAGAACGAACATAAAAGTTCTGCGGCCTGTCCTCCTTTTAACGAGTTTATTAAGAGATGCCAAGATTTGGATAAGATGACGGTCAGTGATGTATTCGCCATCCAACTCATGCAGGTCCCGCAGGTGACGGAGGAAATTGCGATTGCTGTTCTCGATTTGTACCCTACACTGCTATCTCTTGCTCGCATACTCTCTTTAACTCAACACAAAAACAATACTAAGTTAATGAGCTGCTCCATACTCTCAAAGGGTTCGGGCCATCAGAAGGAGGGGGACGTATGTGCACAAGAGGAAATGCTTAAGCAGCAGAGCAATAATGTAATAAGTGGAGTTGCTAGTAGAAATATCTTCCAACTAGTTTGGGGCAGTTGA

Network for GWHGAAZE031761

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08991	MUS81	Homologous recombination	map03440
K08991	MUS81	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.234
	SRR3591706	second leaf	0.648
	SRR3591707	mature leaf	0.565
	SRR3591708	Shoot apex	11.854
	SRR3591709	Stem	2.401
	SRR3591710	White floral bud	1.624
	SRR3591711	White flower	2.007
	SRR3591712	Green floral bud	1.450
	SRR3591713	Yellow flower	0.827
SRP173429	SRR8316895	Juvenile bud stage	1.853
	SRR8316896	Juvenile bud stage	2.836
	SRR8316897	Juvenile bud stage	0.402
	SRR8316894	Third green stage	0.481
	SRR8316900	Third green stage	1.022
	SRR8316901	Third green stage	2.072
	SRR8316898	Complete white stage	0.567
	SRR8316899	Complete white stage	1.532
	SRR8316903	Complete white stage	0.825
	SRR8316902	Silver flowering stage	0.183
	SRR8316904	Silver flowering stage	0.234
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.277
	SRR8316907	Gold flowering stage	0.399
	SRR8316908	Gold flowering stage	0.233
SRP132670	SRR6706286	Control	2.917
	SRR6706287	Light intensity 50%	1.591
	SRR6706288	Light intensity 20%	1.821
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.638
	CNS0095593	Slightly white alabastrum(diploid) 2	4.984
	CNS0095594	Slightly white alabastrum(diploid) 3	3.618
	CNS0095595	Whole white alabastrum(diploid) 2	4.133
	CNS0095596	Whole white alabastrum(diploid) 3	5.863
	CNS0095597	Whole white alabastrum(diploid) 4	4.079
	CNS0095598	Silvery flower (diploied) 1	0.541
	CNS0095599	Silvery flower (diploied) 2	2.560
	CNS0095600	Silvery flower (diploied) 3	0.655
	CNS0095601	Golden flower (diploid) 1	2.052
	CNS0095602	Golden flower (diploid) 2	1.086
	CNS0095603	Golden flower (diploid) 3	0.746
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.502
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.186
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.167
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.785
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.838
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.912
	CNS0095610	Silvery flower (tetraploid) 1	0.630
	CNS0095611	Silvery flower (tetraploid) 2	0.914
	CNS0095612	Silvery flower (tetraploid) 3	0.389
	CNS0095613	Golden flower (tetraploid) 1	0.376
	CNS0095614	Golden flower (tetraploid) 2	0.899
	CNS0095615	Golden flower (tetraploid) 3	0.124
CRA001975	CRR073297	Stem 1	1.981
	CRR073298	Stem 2	1.544
	CRR073299	Stem 3	1.498
	CRR073300	Leaf 1	2.051
	CRR073301	Leaf 2	1.931
	CRR073302	Leaf 3	0.434
	CRR073303	Juvenile bud 1	0.802
	CRR073304	Juvenile bud 2	0.122
	CRR073305	Juvenile bud 3	1.932
	CRR073306	Third green 1	0.221
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.578
	CRR073309	Second white 1	0.047
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.131
	CRR073312	Silver flowering 1	0.633
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.145
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.257
	CRR073317	Gold flowering 3	0.224
	CRR073318	Tawny withering 1	2.490
	CRR073319	Tawny withering 2	2.487
	CRR073320	Tawny withering 3	1.750