Gene detail

Detail information of GWHGAAZE031758

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010645695.1	1.39801E-50	PREDICTED: crossover junction endonuclease MUS81 isoform X5 [Vitis vinifera]
Swissprot	tr\|Q5W9E7\|MUS81_ARATH	1E-38	Crossover junction endonuclease MUS81
trEMBL	tr\|D7SQ12\|D7SQ12_VITVI	5E-51	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI17741.3}
TAIR10	AT4G30870.1	1E-33	Restriction endonuclease, type II-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	64554830	64559768	+
GWHAAZE00000009	mRNA	64554830	64559768	+
GWHAAZE00000009	exon	64554830	64555129	+
GWHAAZE00000009	exon	64559509	64559597	+
GWHAAZE00000009	exon	64559686	64559768	+
GWHAAZE00000009	five_prime_UTR	64554830	64554935	+
GWHAAZE00000009	CDS	64554936	64555129	+
GWHAAZE00000009	CDS	64559509	64559597	+
GWHAAZE00000009	CDS	64559686	64559768	+

Transcript Sequence
>GWHTAAZE031796 CGCGAGTTCCTGTTCTTCGATAGATTCTTCTCCAACCCCCCCCCTTTTTTTCTTTCAAAACCCTTTTTCTTCTTTTTTAAAAAAAACCTAAATCGATCGATAAGAGATGGAAAAGCAGAGACAAGTGGTGTGTAACGATAACAAAGAGCTCGCAAATTTCATATGGGATAAGAGACAAGAGATTGCCCAAAGATCCAAAGGGATTTCGGAGAATATTGATATGACTCTTTATAAGGCTTATTCCAATGTTTGCAATTGCAAAAACCCGATTACAACTATTAAGGAGTTTGCTAAAATAAAGGGTGTTGGAAAATGGATTTTGAGGCTTATGCAAGGTTTCTTTGAGACTGATAGCAGTGCTTCTGAAAATGAAGAGTTGACGAAAAAGGGGAAGAAAATTAACAGAACTAAGCGCTACATGCCTCAAAAGAATTCTGTAGCCTATTCGTTGTTGATTACTCTTTACAGGTAG

Network for GWHGAAZE031758

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08991	MUS81	Homologous recombination	map03440
K08991	MUS81	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.132
	SRR3591706	second leaf	1.044
	SRR3591707	mature leaf	0.223
	SRR3591708	Shoot apex	3.498
	SRR3591709	Stem	0.886
	SRR3591710	White floral bud	0.876
	SRR3591711	White flower	0.835
	SRR3591712	Green floral bud	0.752
	SRR3591713	Yellow flower	0.915
SRP173429	SRR8316895	Juvenile bud stage	1.247
	SRR8316896	Juvenile bud stage	1.375
	SRR8316897	Juvenile bud stage	0.403
	SRR8316894	Third green stage	0.383
	SRR8316900	Third green stage	0.792
	SRR8316901	Third green stage	0.908
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.863
	SRR8316903	Complete white stage	0.217
	SRR8316902	Silver flowering stage	0.255
	SRR8316904	Silver flowering stage	0.073
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.272
	SRR8316907	Gold flowering stage	0.467
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.690
	SRR6706287	Light intensity 50%	0.777
	SRR6706288	Light intensity 20%	0.523
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.499
	CNS0095593	Slightly white alabastrum(diploid) 2	0.381
	CNS0095594	Slightly white alabastrum(diploid) 3	1.620
	CNS0095595	Whole white alabastrum(diploid) 2	0.806
	CNS0095596	Whole white alabastrum(diploid) 3	0.332
	CNS0095597	Whole white alabastrum(diploid) 4	1.009
	CNS0095598	Silvery flower (diploied) 1	0.543
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.046
	CNS0095601	Golden flower (diploid) 1	0.584
	CNS0095602	Golden flower (diploid) 2	1.061
	CNS0095603	Golden flower (diploid) 3	0.564
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.929
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.376
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.039
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.977
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.293
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.813
	CNS0095610	Silvery flower (tetraploid) 1	0.487
	CNS0095611	Silvery flower (tetraploid) 2	0.613
	CNS0095612	Silvery flower (tetraploid) 3	0.220
	CNS0095613	Golden flower (tetraploid) 1	0.077
	CNS0095614	Golden flower (tetraploid) 2	0.448
	CNS0095615	Golden flower (tetraploid) 3	0.095
CRA001975	CRR073297	Stem 1	0.341
	CRR073298	Stem 2	0.350
	CRR073299	Stem 3	0.083
	CRR073300	Leaf 1	0.365
	CRR073301	Leaf 2	0.397
	CRR073302	Leaf 3	0.343
	CRR073303	Juvenile bud 1	0.367
	CRR073304	Juvenile bud 2	0.262
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.059
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.198
	CRR073313	Silver flowering 2	0.072
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.073
	CRR073318	Tawny withering 1	0.053
	CRR073319	Tawny withering 2	0.412
	CRR073320	Tawny withering 3	0.186