Gene detail

Detail information of GWHGAAZE031643

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011083138.1	3.4248E-71	PREDICTED: zinc finger CCCH domain-containing protein 44-like [Sesamum indicum]
Swissprot	tr\|Q69XQ3\|C3H44_ORYSJ	2E-55	Zinc finger CCCH domain-containing protein 44
trEMBL	tr\|A0A068VA91\|A0A068VA91_COFCA	1E-68	Coffea canephora DH200=94 genomic scaffold, scaffold_166 {ECO:0000313\|EMBL:CDP17507.1}
TAIR10	AT3G12130.1	2E-37	KH domain-containing protein / zinc finger (CCCH type) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	62314871	62315572	-
GWHAAZE00000009	mRNA	62314871	62315572	-
GWHAAZE00000009	exon	62315560	62315572	-
GWHAAZE00000009	exon	62315029	62315400	-
GWHAAZE00000009	exon	62314871	62314998	-
GWHAAZE00000009	CDS	62315560	62315572	-
GWHAAZE00000009	CDS	62315029	62315400	-
GWHAAZE00000009	CDS	62314871	62314998	-

Transcript Sequence
>GWHTAAZE031681 ATGGCAAATCTTGGTTTCCCATCTTACGAGGACCCTCGAGCCATGGGTGGCCCACCACCAATGCACTACGGCTTTCCTCCACGTGGTGAACCGTCGCCTCCCGGTATAGCCGCTGCAGCCAACTTTGGTGCCTCAGCTACAGCCAAGATAAGCATAGATGCATCCCTTGCCGGAGCTGTTATCGGAAAGGGTGGGGTGAACTCAAAGCAGATATGTAGGCTTACCGGCGTTAAGCTCGCTATAAGAGAGCACGATGCCGACCCGAACCAGAGGAACATTGAGCTTGAAGGGACGTTTGACCAGATCAAACAGGCTAGTGCTATGGTTCGTGAGCTGATCATGAACCTCGCCGCACCCACAGGTCCACCCTCTAGACACTCTGGTGGTAATAAAGCTCCTTCGGGCAATTTTAAAACGAAGGTTTGTGAAAATTTTGCAAAGGGGTCGTGTACTTTTGGAGAGAGGTGCCATTTCGCACATGGAGATGAGGAGCTGCGCAAGCCAGTGGGTTGA

Network for GWHGAAZE031643

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00013.30	KH_1	47	111	3.10E-12
PF00642.25	zf-CCCH	137	161	5.20E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C3H

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding
GO:0003723	molecular_function	RNA binding
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.742
	SRR3591706	second leaf	31.218
	SRR3591707	mature leaf	22.964
	SRR3591708	Shoot apex	78.308
	SRR3591709	Stem	31.175
	SRR3591710	White floral bud	28.738
	SRR3591711	White flower	54.357
	SRR3591712	Green floral bud	31.203
	SRR3591713	Yellow flower	80.035
SRP173429	SRR8316895	Juvenile bud stage	25.242
	SRR8316896	Juvenile bud stage	29.069
	SRR8316897	Juvenile bud stage	15.627
	SRR8316894	Third green stage	9.625
	SRR8316900	Third green stage	26.841
	SRR8316901	Third green stage	34.645
	SRR8316898	Complete white stage	15.124
	SRR8316899	Complete white stage	45.912
	SRR8316903	Complete white stage	24.593
	SRR8316902	Silver flowering stage	16.176
	SRR8316904	Silver flowering stage	18.007
	SRR8316905	Silver flowering stage	10.619
	SRR8316906	Gold flowering stage	29.936
	SRR8316907	Gold flowering stage	22.201
	SRR8316908	Gold flowering stage	32.126
SRP132670	SRR6706286	Control	25.413
	SRR6706287	Light intensity 50%	26.800
	SRR6706288	Light intensity 20%	27.066
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.248
	CNS0095593	Slightly white alabastrum(diploid) 2	38.086
	CNS0095594	Slightly white alabastrum(diploid) 3	35.309
	CNS0095595	Whole white alabastrum(diploid) 2	27.349
	CNS0095596	Whole white alabastrum(diploid) 3	26.373
	CNS0095597	Whole white alabastrum(diploid) 4	27.130
	CNS0095598	Silvery flower (diploied) 1	29.007
	CNS0095599	Silvery flower (diploied) 2	31.438
	CNS0095600	Silvery flower (diploied) 3	35.133
	CNS0095601	Golden flower (diploid) 1	27.862
	CNS0095602	Golden flower (diploid) 2	44.800
	CNS0095603	Golden flower (diploid) 3	38.209
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.538
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.254
	CNS0095606	Slightly white alabastrum(tetraploid) 3	46.705
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.880
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.327
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.797
	CNS0095610	Silvery flower (tetraploid) 1	32.844
	CNS0095611	Silvery flower (tetraploid) 2	31.616
	CNS0095612	Silvery flower (tetraploid) 3	18.004
	CNS0095613	Golden flower (tetraploid) 1	36.669
	CNS0095614	Golden flower (tetraploid) 2	37.964
	CNS0095615	Golden flower (tetraploid) 3	67.576
CRA001975	CRR073297	Stem 1	40.485
	CRR073298	Stem 2	35.740
	CRR073299	Stem 3	45.551
	CRR073300	Leaf 1	35.641
	CRR073301	Leaf 2	42.381
	CRR073302	Leaf 3	30.223
	CRR073303	Juvenile bud 1	38.019
	CRR073304	Juvenile bud 2	30.985
	CRR073305	Juvenile bud 3	35.051
	CRR073306	Third green 1	14.876
	CRR073307	Third green 2	11.263
	CRR073308	Third green 3	12.104
	CRR073309	Second white 1	12.348
	CRR073310	Second white 2	9.504
	CRR073311	Second white 3	11.753
	CRR073312	Silver flowering 1	12.387
	CRR073313	Silver flowering 2	11.940
	CRR073314	Silver flowering 3	13.945
	CRR073315	Gold flowering 1	39.393
	CRR073316	Gold flowering 2	40.986
	CRR073317	Gold flowering 3	30.324
	CRR073318	Tawny withering 1	55.586
	CRR073319	Tawny withering 2	50.192
	CRR073320	Tawny withering 3	68.700