Gene detail

Detail information of GWHGAAZE031602

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP11320.1	8.56851E-41	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LF66\|Y5758_ARATH	3E-23	BTB/POZ domain-containing protein At5g17580
trEMBL	tr\|A0A068US10\|A0A068US10_COFCA	3E-41	Coffea canephora DH200=94 genomic scaffold, scaffold_54 {ECO:0000313\|EMBL:CDP11320.1}
TAIR10	AT5G17580.1	8E-15	Phototropic-responsive NPH3 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	61508309	61509447	-
GWHAAZE00000009	mRNA	61508309	61509447	-
GWHAAZE00000009	exon	61508309	61508650	-
GWHAAZE00000009	exon	61509258	61509327	-
GWHAAZE00000009	exon	61509413	61509447	-
GWHAAZE00000009	CDS	61509413	61509447	-
GWHAAZE00000009	CDS	61509258	61509327	-
GWHAAZE00000009	CDS	61508309	61508650	-

Transcript Sequence
>GWHTAAZE031638 ATGGCCACTAGACAACGCATAGAATCATCATCTGGGATGCCGAAATCTACATTTTCAAAAGATGTCCAGCTCCATTTTTGTGGGGTACCCTTCACTTTGGACAGGGAACTTCTAGCTGCAAGATCAGCTAAACTAGCTTCATTGCTCAAAGACCACCCTCAAGAAGATCTCTCCCACTTGCTCGGGGACATGCCTGCTGACCCAAACACTTTCGAGCTTGTAGGCCGATTCTGCCATGGCTGTGAAGTCAACATTTCAACAGAAAATGTCATTCGAGTCTCTTGCCTTGCTAGCTACCTTCAAATGACCGAAATTCACAGCCCCAACAATCTATTAAAGAAATCTCTCACTTTCTTGAGCAGAAAGTCATCCCTAGTTGGAATAAATCCATACGAGCCCTCAAATCCACAGAAAATATTCTTCAACAAGCGGCAAATCTTGGCTTGA

Network for GWHGAAZE031602

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	TRAF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.509
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.433
	SRR3591709	Stem	0.593
	SRR3591710	White floral bud	0.100
	SRR3591711	White flower	0.095
	SRR3591712	Green floral bud	0.069
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.878
	SRR8316896	Juvenile bud stage	1.111
	SRR8316897	Juvenile bud stage	0.208
	SRR8316894	Third green stage	0.377
	SRR8316900	Third green stage	0.531
	SRR8316901	Third green stage	0.366
	SRR8316898	Complete white stage	0.088
	SRR8316899	Complete white stage	0.039
	SRR8316903	Complete white stage	0.458
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.076
	SRR8316905	Silver flowering stage	0.077
	SRR8316906	Gold flowering stage	0.085
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.009
SRP132670	SRR6706286	Control	0.699
	SRR6706287	Light intensity 50%	0.663
	SRR6706288	Light intensity 20%	0.637
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.119
	CNS0095593	Slightly white alabastrum(diploid) 2	0.538
	CNS0095594	Slightly white alabastrum(diploid) 3	0.843
	CNS0095595	Whole white alabastrum(diploid) 2	0.416
	CNS0095596	Whole white alabastrum(diploid) 3	0.126
	CNS0095597	Whole white alabastrum(diploid) 4	0.167
	CNS0095598	Silvery flower (diploied) 1	2.065
	CNS0095599	Silvery flower (diploied) 2	2.319
	CNS0095600	Silvery flower (diploied) 3	0.543
	CNS0095601	Golden flower (diploid) 1	1.101
	CNS0095602	Golden flower (diploid) 2	0.578
	CNS0095603	Golden flower (diploid) 3	0.791
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.424
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.290
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.231
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.171
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.305
	CNS0095610	Silvery flower (tetraploid) 1	0.371
	CNS0095611	Silvery flower (tetraploid) 2	0.481
	CNS0095612	Silvery flower (tetraploid) 3	0.237
	CNS0095613	Golden flower (tetraploid) 1	0.047
	CNS0095614	Golden flower (tetraploid) 2	0.134
	CNS0095615	Golden flower (tetraploid) 3	0.145
CRA001975	CRR073297	Stem 1	2.121
	CRR073298	Stem 2	0.539
	CRR073299	Stem 3	1.480
	CRR073300	Leaf 1	0.874
	CRR073301	Leaf 2	0.757
	CRR073302	Leaf 3	0.357
	CRR073303	Juvenile bud 1	0.145
	CRR073304	Juvenile bud 2	0.294
	CRR073305	Juvenile bud 3	0.331
	CRR073306	Third green 1	0.413
	CRR073307	Third green 2	0.165
	CRR073308	Third green 3	0.400
	CRR073309	Second white 1	0.420
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.405
	CRR073312	Silver flowering 1	0.276
	CRR073313	Silver flowering 2	0.151
	CRR073314	Silver flowering 3	0.226
	CRR073315	Gold flowering 1	0.274
	CRR073316	Gold flowering 2	0.830
	CRR073317	Gold flowering 3	0.048
	CRR073318	Tawny withering 1	0.252
	CRR073319	Tawny withering 2	1.046
	CRR073320	Tawny withering 3	0.253