Gene detail

Detail information of GWHGAAZE031582

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP09315.1	8.3143E-24	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8VXX4\|RFC3_ARATH	0.0000005	Replication factor C subunit 3
trEMBL	tr\|A0A068ULA5\|A0A068ULA5_COFCA	3E-24	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09315.1}
TAIR10	AT5G27740.1	0.000008	ATPase family associated with various cellular activities (AAA)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	61215571	61215840	-
GWHAAZE00000009	mRNA	61215571	61215840	-
GWHAAZE00000009	exon	61215571	61215640	-
GWHAAZE00000009	exon	61215731	61215840	-
GWHAAZE00000009	CDS	61215731	61215840	-
GWHAAZE00000009	CDS	61215571	61215640	-

Transcript Sequence
>GWHTAAZE031618 ATGATCACATGCAGCCCCACCTTGAAGGAAGATCAAGAAATCTTGACCGGTTGGGAAGATGATATTGCAAAAATTGCCAAAAATGTAGTAGATGAGCAAAGCCCGAAACAGCTATATAACATCCGTGGGAAACTTCAAAAACTAATAGAGCACAATGTATCCCCTGAGTTCATTTTCCAA

Network for GWHGAAZE031582

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10756	RFC3_5	DNA replication	map03030
		Nucleotide excision repair	map03420
		Mismatch repair	map03430

Gene Ontology

GO term	Ontology	Name
GO:0006260	biological_process	DNA replication
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.703
	SRR3591706	second leaf	0.345
	SRR3591707	mature leaf	0.249
	SRR3591708	Shoot apex	0.763
	SRR3591709	Stem	0.900
	SRR3591710	White floral bud	0.349
	SRR3591711	White flower	0.082
	SRR3591712	Green floral bud	0.224
	SRR3591713	Yellow flower	1.260
SRP173429	SRR8316895	Juvenile bud stage	0.645
	SRR8316896	Juvenile bud stage	1.777
	SRR8316897	Juvenile bud stage	0.354
	SRR8316894	Third green stage	0.200
	SRR8316900	Third green stage	0.657
	SRR8316901	Third green stage	1.409
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.370
	SRR8316903	Complete white stage	1.750
	SRR8316902	Silver flowering stage	0.239
	SRR8316904	Silver flowering stage	1.534
	SRR8316905	Silver flowering stage	0.165
	SRR8316906	Gold flowering stage	1.712
	SRR8316907	Gold flowering stage	0.930
	SRR8316908	Gold flowering stage	1.829
SRP132670	SRR6706286	Control	0.090
	SRR6706287	Light intensity 50%	0.168
	SRR6706288	Light intensity 20%	0.436
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.908
	CNS0095593	Slightly white alabastrum(diploid) 2	0.835
	CNS0095594	Slightly white alabastrum(diploid) 3	0.354
	CNS0095595	Whole white alabastrum(diploid) 2	2.023
	CNS0095596	Whole white alabastrum(diploid) 3	0.135
	CNS0095597	Whole white alabastrum(diploid) 4	0.429
	CNS0095598	Silvery flower (diploied) 1	1.192
	CNS0095599	Silvery flower (diploied) 2	0.196
	CNS0095600	Silvery flower (diploied) 3	2.285
	CNS0095601	Golden flower (diploid) 1	1.647
	CNS0095602	Golden flower (diploid) 2	2.164
	CNS0095603	Golden flower (diploid) 3	1.417
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.515
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.060
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.193
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.711
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.011
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.496
	CNS0095610	Silvery flower (tetraploid) 1	3.229
	CNS0095611	Silvery flower (tetraploid) 2	2.301
	CNS0095612	Silvery flower (tetraploid) 3	5.161
	CNS0095613	Golden flower (tetraploid) 1	4.216
	CNS0095614	Golden flower (tetraploid) 2	3.809
	CNS0095615	Golden flower (tetraploid) 3	2.732
CRA001975	CRR073297	Stem 1	0.312
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.201
	CRR073301	Leaf 2	0.451
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.001
	CRR073310	Second white 2	0.545
	CRR073311	Second white 3	1.578
	CRR073312	Silver flowering 1	0.678
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.119
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.694
	CRR073319	Tawny withering 2	0.114
	CRR073320	Tawny withering 3	0.092