Gene detail

Detail information of GWHGAAZE031524

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011023121.1	4.34187E-77	PREDICTED: homeobox-leucine zipper protein ATHB-7-like [Populus euphratica]
Swissprot	tr\|P46897\|ATHB7_ARATH	1E-58	Homeobox-leucine zipper protein ATHB-7
trEMBL	tr\|B9GR61\|B9GR61_POPTR	1E-75	Homeobox leucine zipper family protein {ECO:0000313\|EMBL:EEE81932.1}
TAIR10	AT2G46680.1	1E-46	homeobox 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	60239113	60240071	-
GWHAAZE00000009	mRNA	60239113	60240071	-
GWHAAZE00000009	exon	60239113	60239421	-
GWHAAZE00000009	exon	60239721	60240071	-
GWHAAZE00000009	CDS	60239721	60240071	-
GWHAAZE00000009	CDS	60239113	60239421	-

Transcript Sequence
>GWHTAAZE031560 ATGTTAAGCGGAGAAGAGCACTCTACCTCGGGGGAGACAAAGTATATCCACATGGACGACTTGAAGAGAAAGAAGAGGAGCAAAGAGAAAAAGAGGTTCAGTGACAACCAGATCAGATCGATGGAGTCCATCTTCGTGTCTGAGTCGAAGCTTGAGCCGCGAAAGAAGCTGCAGCTGGCTGAAGAGATTGGCTTAGAACCGCGACAAGTTGCCATTTGGTTTCAAAATAAAAGGGCTCGATGGAAGTCCAAGCAGCTCGAGAGGGAGTACAACATACTACGGGCCAATTACAATTCTCTCGCTTCTCAATTCGAAGTACTGAACAAAGAGAAGCAATCTTTAGCTACACAGTTGCAAAGGCTCCGTGGTCTGCTGGAGGATAGGACCGATGGAAAATTAAAAGCTATCGAGAACATCAATGGCGAATCTGAGGTGCGACTAGGTTTGTCGCTGGATGGATCAGAGCACGGAGTGGGTGTGCTTTCGGATGAAGATAGCAGCATAAAGGCAGAGTACATGGCGCTAGATGAGGAGACTGATCAGCTTCTGAATATGGTGGAGCCTGTAGATGATTCACCTGATAATTGGGGAAGTTTAGACTCTAATGGTCTATTAGATGAGTCAAGCAGTAGTTATCAGTGGTGGAACTTCTGGTCTTGA

Network for GWHGAAZE031524

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	28	82	3.50E-16
PF02183.19	HALZ	84	125	4.60E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.969
	SRR3591706	second leaf	13.846
	SRR3591707	mature leaf	51.013
	SRR3591708	Shoot apex	9.598
	SRR3591709	Stem	8.992
	SRR3591710	White floral bud	9.187
	SRR3591711	White flower	46.455
	SRR3591712	Green floral bud	0.349
	SRR3591713	Yellow flower	57.027
SRP173429	SRR8316895	Juvenile bud stage	0.208
	SRR8316896	Juvenile bud stage	0.846
	SRR8316897	Juvenile bud stage	0.303
	SRR8316894	Third green stage	0.075
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.108
	SRR8316899	Complete white stage	0.703
	SRR8316903	Complete white stage	3.671
	SRR8316902	Silver flowering stage	13.324
	SRR8316904	Silver flowering stage	7.274
	SRR8316905	Silver flowering stage	4.746
	SRR8316906	Gold flowering stage	17.271
	SRR8316907	Gold flowering stage	22.828
	SRR8316908	Gold flowering stage	18.724
SRP132670	SRR6706286	Control	0.573
	SRR6706287	Light intensity 50%	0.606
	SRR6706288	Light intensity 20%	0.261
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.685
	CNS0095593	Slightly white alabastrum(diploid) 2	0.847
	CNS0095594	Slightly white alabastrum(diploid) 3	2.156
	CNS0095595	Whole white alabastrum(diploid) 2	1.407
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.299
	CNS0095598	Silvery flower (diploied) 1	14.254
	CNS0095599	Silvery flower (diploied) 2	10.007
	CNS0095600	Silvery flower (diploied) 3	7.373
	CNS0095601	Golden flower (diploid) 1	19.142
	CNS0095602	Golden flower (diploid) 2	23.723
	CNS0095603	Golden flower (diploid) 3	21.067
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.271
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.185
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.477
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	23.595
	CNS0095611	Silvery flower (tetraploid) 2	26.134
	CNS0095612	Silvery flower (tetraploid) 3	14.000
	CNS0095613	Golden flower (tetraploid) 1	30.996
	CNS0095614	Golden flower (tetraploid) 2	33.685
	CNS0095615	Golden flower (tetraploid) 3	56.775
CRA001975	CRR073297	Stem 1	12.600
	CRR073298	Stem 2	7.311
	CRR073299	Stem 3	8.140
	CRR073300	Leaf 1	0.029
	CRR073301	Leaf 2	0.681
	CRR073302	Leaf 3	0.539
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.598
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	2.380
	CRR073307	Third green 2	1.154
	CRR073308	Third green 3	3.366
	CRR073309	Second white 1	10.959
	CRR073310	Second white 2	16.258
	CRR073311	Second white 3	13.407
	CRR073312	Silver flowering 1	15.471
	CRR073313	Silver flowering 2	14.003
	CRR073314	Silver flowering 3	7.617
	CRR073315	Gold flowering 1	12.186
	CRR073316	Gold flowering 2	17.755
	CRR073317	Gold flowering 3	6.223
	CRR073318	Tawny withering 1	9.716
	CRR073319	Tawny withering 2	19.699
	CRR073320	Tawny withering 3	2.293