Gene detail

Detail information of GWHGAAZE031510

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002263994.1	1.65706E-72	PREDICTED: ethylene-responsive transcription factor ERF023 [Vitis vinifera]
Swissprot	tr\|Q1ECI2\|ERF23_ARATH	3E-54	Ethylene-responsive transcription factor ERF023
trEMBL	tr\|F6I6F1\|F6I6F1_VITVI	6E-73	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB62547.1}
TAIR10	AT1G01250.1	2E-39	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59973201	59973740	+
GWHAAZE00000009	mRNA	59973201	59973740	+
GWHAAZE00000009	exon	59973201	59973740	+
GWHAAZE00000009	CDS	59973201	59973740	+

Transcript Sequence
>GWHTAAZE031546 ATGGAGCGATCACCACCATGCACTGAAGATGAACTAATCTCCTCGCCGGATAACACCACCGCCGCAGGGAACCACCGCCGTACAGGCGGCACAAGGCATCCAAAATACCGCGGAGTGAGAAAAAGGCGGTGGGGCAAATGGGTGTCCGAAATTCGAGAACCCCGGAAAAAATCACGTATATGGCTAGGATCCTTTCCGACACCGGAGATGGCGGCGCGTGCATACGACGTGGCGGCGTATTGCCTCAAGGGGCACAAGGCACAGCTCAATTTTCCAGATGATGTGGAGTTAATGCCCCGGCCATCGACTTGCTCGGCGCGTGACATTCAGGCAGCGGCGGCCACAGCGGCGCGTGAAGTTCAAGCGGTGGAGAAGAAGGTGGAGGGTGACGGCGGCGATGATTTCTGGGGTGAGATTGAGTTGCCGGAGCTGATGAATGGTGGGAGAGACGTTTGGTCCGAGAGTGTGGGGGAATTTTTGCCTGAGGTAAGGTATTGGAATTCTTATGGTGGGGCGTTATCTGGTGACGCCACGTGGTAA

Network for GWHGAAZE031510

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	34	85	1.50E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.164
	SRR3591706	second leaf	34.079
	SRR3591707	mature leaf	8.318
	SRR3591708	Shoot apex	38.341
	SRR3591709	Stem	3.445
	SRR3591710	White floral bud	54.990
	SRR3591711	White flower	6.028
	SRR3591712	Green floral bud	36.751
	SRR3591713	Yellow flower	1.526
SRP173429	SRR8316895	Juvenile bud stage	2.632
	SRR8316896	Juvenile bud stage	3.753
	SRR8316897	Juvenile bud stage	0.842
	SRR8316894	Third green stage	2.818
	SRR8316900	Third green stage	9.041
	SRR8316901	Third green stage	10.498
	SRR8316898	Complete white stage	7.126
	SRR8316899	Complete white stage	27.166
	SRR8316903	Complete white stage	13.377
	SRR8316902	Silver flowering stage	0.613
	SRR8316904	Silver flowering stage	2.463
	SRR8316905	Silver flowering stage	1.072
	SRR8316906	Gold flowering stage	0.400
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.925
SRP132670	SRR6706286	Control	20.652
	SRR6706287	Light intensity 50%	22.000
	SRR6706288	Light intensity 20%	22.522
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.194
	CNS0095593	Slightly white alabastrum(diploid) 2	13.736
	CNS0095594	Slightly white alabastrum(diploid) 3	6.589
	CNS0095595	Whole white alabastrum(diploid) 2	18.749
	CNS0095596	Whole white alabastrum(diploid) 3	27.032
	CNS0095597	Whole white alabastrum(diploid) 4	23.564
	CNS0095598	Silvery flower (diploied) 1	3.810
	CNS0095599	Silvery flower (diploied) 2	9.720
	CNS0095600	Silvery flower (diploied) 3	7.410
	CNS0095601	Golden flower (diploid) 1	2.409
	CNS0095602	Golden flower (diploid) 2	1.963
	CNS0095603	Golden flower (diploid) 3	2.093
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.930
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.678
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.199
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.290
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.763
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.128
	CNS0095610	Silvery flower (tetraploid) 1	12.977
	CNS0095611	Silvery flower (tetraploid) 2	13.897
	CNS0095612	Silvery flower (tetraploid) 3	10.546
	CNS0095613	Golden flower (tetraploid) 1	0.395
	CNS0095614	Golden flower (tetraploid) 2	4.378
	CNS0095615	Golden flower (tetraploid) 3	1.005
CRA001975	CRR073297	Stem 1	2.350
	CRR073298	Stem 2	3.774
	CRR073299	Stem 3	7.155
	CRR073300	Leaf 1	12.713
	CRR073301	Leaf 2	5.329
	CRR073302	Leaf 3	11.318
	CRR073303	Juvenile bud 1	16.202
	CRR073304	Juvenile bud 2	13.581
	CRR073305	Juvenile bud 3	12.409
	CRR073306	Third green 1	5.152
	CRR073307	Third green 2	13.162
	CRR073308	Third green 3	10.211
	CRR073309	Second white 1	0.115
	CRR073310	Second white 2	1.039
	CRR073311	Second white 3	0.160
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.225
	CRR073316	Gold flowering 2	1.894
	CRR073317	Gold flowering 3	10.919
	CRR073318	Tawny withering 1	1.202
	CRR073319	Tawny withering 2	1.202
	CRR073320	Tawny withering 3	0.107