Gene detail

Detail information of GWHGAAZE031507

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008233133.1	2.12595E-47	PREDICTED: uncharacterized protein LOC103332196 [Prunus mume]
Swissprot	tr\|O65155\|KELP_ARATH	3E-36	RNA polymerase II transcriptional coactivator KELP
trEMBL	tr\|M5XT05\|M5XT05_PRUPE	2E-47	Uncharacterized protein {ECO:0000313\|EMBL:EMJ22165.1}
TAIR10	AT4G10920.2	3E-28	transcriptional coactivator p15 (PC4) family protein (KELP)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59922402	59927459	+
GWHAAZE00000009	mRNA	59922402	59927459	+
GWHAAZE00000009	exon	59922402	59922692	+
GWHAAZE00000009	exon	59922775	59922880	+
GWHAAZE00000009	exon	59926088	59926178	+
GWHAAZE00000009	exon	59927237	59927459	+
GWHAAZE00000009	CDS	59922402	59922692	+
GWHAAZE00000009	CDS	59922775	59922880	+
GWHAAZE00000009	CDS	59926088	59926178	+
GWHAAZE00000009	CDS	59927237	59927459	+

Transcript Sequence
>GWHTAAZE031543 ATGGAATCTGAAACCCTAGGCCGGAAAATCGAAGAGACAATAATCGAAATCCTAAAAAATGCAGACTTGGAAACAATCACCGAGTACAATGTCCGGTCCATTGCTGCCGACCGCCTTGGCATCGACTTCTCCGACCTAGACCGCAAGTGGCTCGTCCGCCGCACCGTCGAATCCTTTTTGCTATCGTCATCGCCGGCGCCGGAAGAACAGACCAAAGAGGTCGTACAAGAACAACAACAACCACCGCATATGACCTGTCCTAATGAAGATGGTGGCCGTGTGATTTGCAAGTTATCAGAGAAGAGGAGTGTGTCAATTCTGAAATTCGGAGAGAAGAATTTGGTGTCAGTTAGAGATTGCTACCAAAAAGATGGGAAGCAGTTTCAATCAGGTAGAGGAATTACGTTGACAGCTAGACAATGGTCAGCTTTTAGGAATAGTGTCCCTGCTATAGAAGATGCCATTACGAAGATGGAATCAAGGATTAGGTCCGAAGATGTTGAAAAGCATATTGAGGCAGCTATGCCTTCATCAACTGCCTCTGCTCTTCAAGAACAAAATCCTAATCCAAGAAAACAAATTGAATCGGAGACATCCAATCTGCCTTCTTCTGTTCGTCAAACAAATGGTTGGCCAAATACTCCAACTCCCTTTTCACCTCAGTCACTTGTTCCCATCGAACCCACCCGTCTAAACGGTAAAAACTACTAT

Network for GWHGAAZE031507

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08766.12	DEK_C	9	60	5.40E-09
PF02229.17	PC4	96	146	5.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Coactivator p15

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.201
	SRR3591706	second leaf	8.147
	SRR3591707	mature leaf	6.028
	SRR3591708	Shoot apex	5.393
	SRR3591709	Stem	6.411
	SRR3591710	White floral bud	4.806
	SRR3591711	White flower	5.511
	SRR3591712	Green floral bud	6.656
	SRR3591713	Yellow flower	3.609
SRP173429	SRR8316895	Juvenile bud stage	3.302
	SRR8316896	Juvenile bud stage	5.116
	SRR8316897	Juvenile bud stage	1.401
	SRR8316894	Third green stage	2.610
	SRR8316900	Third green stage	7.099
	SRR8316901	Third green stage	7.020
	SRR8316898	Complete white stage	3.462
	SRR8316899	Complete white stage	7.064
	SRR8316903	Complete white stage	3.358
	SRR8316902	Silver flowering stage	1.662
	SRR8316904	Silver flowering stage	2.373
	SRR8316905	Silver flowering stage	0.822
	SRR8316906	Gold flowering stage	4.431
	SRR8316907	Gold flowering stage	4.555
	SRR8316908	Gold flowering stage	4.580
SRP132670	SRR6706286	Control	9.890
	SRR6706287	Light intensity 50%	9.141
	SRR6706288	Light intensity 20%	10.067
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.328
	CNS0095593	Slightly white alabastrum(diploid) 2	3.327
	CNS0095594	Slightly white alabastrum(diploid) 3	3.301
	CNS0095595	Whole white alabastrum(diploid) 2	4.285
	CNS0095596	Whole white alabastrum(diploid) 3	4.827
	CNS0095597	Whole white alabastrum(diploid) 4	3.101
	CNS0095598	Silvery flower (diploied) 1	1.913
	CNS0095599	Silvery flower (diploied) 2	3.606
	CNS0095600	Silvery flower (diploied) 3	5.855
	CNS0095601	Golden flower (diploid) 1	4.768
	CNS0095602	Golden flower (diploid) 2	3.822
	CNS0095603	Golden flower (diploid) 3	4.881
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.974
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.753
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.793
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.348
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.150
	CNS0095610	Silvery flower (tetraploid) 1	6.723
	CNS0095611	Silvery flower (tetraploid) 2	7.787
	CNS0095612	Silvery flower (tetraploid) 3	8.894
	CNS0095613	Golden flower (tetraploid) 1	3.027
	CNS0095614	Golden flower (tetraploid) 2	4.396
	CNS0095615	Golden flower (tetraploid) 3	3.864
CRA001975	CRR073297	Stem 1	7.313
	CRR073298	Stem 2	9.021
	CRR073299	Stem 3	10.042
	CRR073300	Leaf 1	5.412
	CRR073301	Leaf 2	6.979
	CRR073302	Leaf 3	6.822
	CRR073303	Juvenile bud 1	5.763
	CRR073304	Juvenile bud 2	4.560
	CRR073305	Juvenile bud 3	6.040
	CRR073306	Third green 1	5.272
	CRR073307	Third green 2	5.306
	CRR073308	Third green 3	4.257
	CRR073309	Second white 1	10.288
	CRR073310	Second white 2	7.430
	CRR073311	Second white 3	7.302
	CRR073312	Silver flowering 1	8.314
	CRR073313	Silver flowering 2	8.279
	CRR073314	Silver flowering 3	8.728
	CRR073315	Gold flowering 1	4.970
	CRR073316	Gold flowering 2	5.311
	CRR073317	Gold flowering 3	6.797
	CRR073318	Tawny withering 1	5.260
	CRR073319	Tawny withering 2	3.550
	CRR073320	Tawny withering 3	5.146