Gene detail

Detail information of GWHGAAZE031464

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007051632.1	2.52392E-54	AP2/ERF domain-containing transcription factor, putative [Theobroma cacao]
Swissprot	tr\|Q9SUE3\|CRF4_ARATH	4E-36	Ethylene-responsive transcription factor CRF4
trEMBL	tr\|A0A061DSM4\|A0A061DSM4_THECC	9E-55	AP2/ERF domain-containing transcription factor, putative {ECO:0000313\|EMBL:EOX95789.1}
TAIR10	AT4G27950.1	2E-31	cytokinin response factor 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59269432	59270109	-
GWHAAZE00000009	mRNA	59269432	59270109	-
GWHAAZE00000009	exon	59269432	59270109	-
GWHAAZE00000009	CDS	59269432	59270109	-

Transcript Sequence
>GWHTAAZE031500 ATGTACGTCAATGAGATCCGAATCGAAACCACCGCCGTTGAAAATAAAAGAGGACTTGTCAAGAGGAAAAAGCAGAGAGCGAAACAGAGCTCGCCGGAGAAACTTGGTTTTAGGCAGTGTGCGGCACCCGGGAACAAGTTACGTGGAGTTAGGCAGCGCCCGTGGGGAAAATGGGCCGCGGAGATCCGAGATCCTGCTCAGAAGGCTAGGGTTTGGTTAGGCACGTTCGATACGGCAGAAGAGGCGGCGATTGTGTACGATAGGGCCGCGATTCTAATACGTGGACCGGATGCGATCACAAATTTCATTAAACCTCCGACGAGAGTATCTTCGCCGGAGATCACTATTTCCGAATGTGATTCCAGCAAGGAGTTACCGGATCTCTGTTCACCTACCTCTGTTCTCAACTTTAATTTTAAAAAGGATAAAGATAAAGAGCAATGCAGCAACGAAGGAGGAAAGATTGATGTGGATGATGGTTTGCCCTTGGATTCGGATTTTTTGAATGAATTTTTTGATTTTCGATCTCCATCTCCGGTAATTTACGAAGATAAGAGTATACCCGAGACTGTTGTGGAAGGAGATTTTGGAGACATTTCCTTGGAATTTGATGAGAATTTGAGGTCTTGTTGGTTGGAATTGGATGATTTCTTTGATGATAATCCTTTGAGAAGTTGA

Network for GWHGAAZE031464

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	46	95	1.70E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.639
	SRR3591706	second leaf	0.464
	SRR3591707	mature leaf	0.245
	SRR3591708	Shoot apex	0.439
	SRR3591709	Stem	0.243
	SRR3591710	White floral bud	4.345
	SRR3591711	White flower	1.661
	SRR3591712	Green floral bud	27.995
	SRR3591713	Yellow flower	1.189
SRP173429	SRR8316895	Juvenile bud stage	6.391
	SRR8316896	Juvenile bud stage	14.386
	SRR8316897	Juvenile bud stage	4.655
	SRR8316894	Third green stage	4.912
	SRR8316900	Third green stage	21.611
	SRR8316901	Third green stage	22.331
	SRR8316898	Complete white stage	1.732
	SRR8316899	Complete white stage	13.819
	SRR8316903	Complete white stage	1.623
	SRR8316902	Silver flowering stage	1.727
	SRR8316904	Silver flowering stage	1.813
	SRR8316905	Silver flowering stage	0.332
	SRR8316906	Gold flowering stage	1.121
	SRR8316907	Gold flowering stage	0.576
	SRR8316908	Gold flowering stage	2.073
SRP132670	SRR6706286	Control	10.226
	SRR6706287	Light intensity 50%	9.293
	SRR6706288	Light intensity 20%	11.718
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.088
	CNS0095593	Slightly white alabastrum(diploid) 2	17.947
	CNS0095594	Slightly white alabastrum(diploid) 3	17.816
	CNS0095595	Whole white alabastrum(diploid) 2	9.936
	CNS0095596	Whole white alabastrum(diploid) 3	15.896
	CNS0095597	Whole white alabastrum(diploid) 4	11.989
	CNS0095598	Silvery flower (diploied) 1	1.744
	CNS0095599	Silvery flower (diploied) 2	2.248
	CNS0095600	Silvery flower (diploied) 3	0.781
	CNS0095601	Golden flower (diploid) 1	1.520
	CNS0095602	Golden flower (diploid) 2	0.200
	CNS0095603	Golden flower (diploid) 3	1.134
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.972
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.437
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.044
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.671
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.649
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.720
	CNS0095610	Silvery flower (tetraploid) 1	1.866
	CNS0095611	Silvery flower (tetraploid) 2	1.298
	CNS0095612	Silvery flower (tetraploid) 3	2.394
	CNS0095613	Golden flower (tetraploid) 1	0.875
	CNS0095614	Golden flower (tetraploid) 2	1.790
	CNS0095615	Golden flower (tetraploid) 3	1.401
CRA001975	CRR073297	Stem 1	15.622
	CRR073298	Stem 2	19.812
	CRR073299	Stem 3	12.355
	CRR073300	Leaf 1	31.866
	CRR073301	Leaf 2	22.230
	CRR073302	Leaf 3	32.460
	CRR073303	Juvenile bud 1	30.416
	CRR073304	Juvenile bud 2	25.518
	CRR073305	Juvenile bud 3	17.631
	CRR073306	Third green 1	0.357
	CRR073307	Third green 2	0.975
	CRR073308	Third green 3	2.675
	CRR073309	Second white 1	0.225
	CRR073310	Second white 2	0.609
	CRR073311	Second white 3	3.151
	CRR073312	Silver flowering 1	0.521
	CRR073313	Silver flowering 2	1.313
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.885
	CRR073319	Tawny withering 2	0.252
	CRR073320	Tawny withering 3	0.456