Gene detail

Detail information of GWHGAAZE031248

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004231147.1	1.63553E-48	PREDICTED: ethylene-responsive transcription factor 13-like [Solanum lycopersicum]
Swissprot	tr\|Q40479\|ERF2_TOBAC	1E-38	Ethylene-responsive transcription factor 2
trEMBL	tr\|M1DMP7\|M1DMP7_SOLTU	1E-49	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400091474}
TAIR10	AT2G44840.1	4E-26	ethylene-responsive element binding factor 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	55829113	55829766	-
GWHAAZE00000009	mRNA	55829113	55829766	-
GWHAAZE00000009	exon	55829113	55829766	-
GWHAAZE00000009	CDS	55829113	55829766	-

Transcript Sequence
>GWHTAAZE031282 ATGTATCACCAAACCACATCAGATTTCGACTTCGCCCTTCTCGAATCTATCCAACATTATCTTCTCGACGATTCGGAGACTCCAGAATTTTTTCTGGCGACCGATCCACCGCAAGTTCTTGGCTCGAGTACCAGCTACGGCGCCCAATTTTCGCCGGAAAATACAGACTCCTGGCCGGAACCGGAGTGCAGGGCCGAGCCGACAGAGTTCGAGGCTGCGCGTGGGGAGTCGGCAGAGGCGCGTGGAGTTCACGCTCCTGATTGGAGGCGGTACAGGGGCGTGAGGAGGCGGCCATGGGGGAAGTTTGCGGCGGAGATAAGGGACCCGGCTAAGAAGGGAGCCAGAGTGTGGCTTGGGACCCACGAGACTCCAGAGGATGCAGCTTTGGCTTATGACAGAGCCGCTTTTAAAATACGCGGCTCACGAGCCAAGCTTAATTTTCCGCATTTAATTGGGTCGGATGCTGCGGCTCATAAACGGCATTCACCTGATCCGTCTAGCTCCTCGGAGGAGGTAAGGGGCTCAAATAAGAGGAGGAGACGAAGCACGGCTGGCTCAACGGCTCAAACCGAGCTAAATAGTGATGATTTAGCTGGAGTTTTTCTAATGTACAAATTAACACCTGAAGATGAATTATTACTTAGCTCTTTGTAA

Network for GWHGAAZE031248

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	90	140	1.80E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.132
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.131
	SRR3591711	White flower	0.179
	SRR3591712	Green floral bud	0.492
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.120
	SRR8316901	Third green stage	0.264
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.041
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.039
	SRR6706287	Light intensity 50%	0.039
	SRR6706288	Light intensity 20%	0.175
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.133
	CNS0095593	Slightly white alabastrum(diploid) 2	0.114
	CNS0095594	Slightly white alabastrum(diploid) 3	0.076
	CNS0095595	Whole white alabastrum(diploid) 2	0.405
	CNS0095596	Whole white alabastrum(diploid) 3	0.211
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.031
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.153
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.035
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.849
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.979
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.156
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.261
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.124
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.033
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.149
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.080
	CRR073317	Gold flowering 3	0.111
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.101