Gene detail

Detail information of GWHGAAZE031233

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU20168.1	3.8627E-86	hypothetical protein MIMGU_mgv1a015616mg [Erythranthe guttata]
Swissprot	tr\|P49030\|MGN_ORYSJ	1E-85	Protein mago nashi homolog
trEMBL	tr\|A0A022PZ51\|A0A022PZ51_ERYGU	1E-86	Uncharacterized protein {ECO:0000313\|EMBL:EYU20168.1}
TAIR10	AT1G02140.1	3E-62	mago nashi family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	55498132	55501046	-
GWHAAZE00000009	mRNA	55498132	55501046	-
GWHAAZE00000009	exon	55498132	55498299	-
GWHAAZE00000009	exon	55499095	55499271	-
GWHAAZE00000009	exon	55500813	55501046	-
GWHAAZE00000009	CDS	55500813	55501046	-
GWHAAZE00000009	CDS	55499095	55499271	-
GWHAAZE00000009	CDS	55498132	55498299	-

Transcript Sequence
>GWHTAAZE031267 ATGGCTAGTGGAGAAGGAGGAGGAGGAGAAGAAGCGGGAGAGTTCTATCTGAGGTATTATGTGGGTCACAAGGGGAAATTTGGGCACGAGTTCTTGGAATTCGAGTTCAGGCCAGACGGAAAGCTGAGATACGCAAACAACTCAAATTACAAGAACGACACCATGATCCGCAAAGAAATCTTCCTCACGCCTTCCGTCCTCCGTGAGTGCCGCCGCATCATCTCCTCCAGCGAAATCATGAAGGAAGATGATAGTAACTGGCCAGAACCAGACCGCGTAGGTCGGCAAGAGCTGGAAATAGTGATGGGTAATGAACATATCTCCTTCACTACTTCTAAGATTGGCTCTCTTATGGATGTCCAGACCAGTAAAGACCCCGAAGGCCTTCGTATTTTCTATTATCTTGTTCAGGGTGGGAACAGAGGTGCCCTAACTGAGAGCAAGCAAAAAAGGAACACCAAATATATGCATCTGAATTGTTGGTGGTGTGGTAATCAAGTAGATGAGCGAAGGGAGAAAGCAGTAAACGAAGTAGTACCATACAAGATATTTCATGGAAAACAACTCCAAGGAAAATGA

Network for GWHGAAZE031233

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02792.15	Mago_nashi	15	137	1.70E-65

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12877	MAGOH	Spliceosome	map03040
		RNA transport	map03013
		mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0008380	biological_process	RNA splicing
GO:0035145	cellular_component	exon-exon junction complex
GO:0005634	cellular_component	nucleus

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	78.904
	SRR3591706	second leaf	55.135
	SRR3591707	mature leaf	35.992
	SRR3591708	Shoot apex	86.631
	SRR3591709	Stem	72.228
	SRR3591710	White floral bud	76.587
	SRR3591711	White flower	67.645
	SRR3591712	Green floral bud	104.218
	SRR3591713	Yellow flower	52.308
SRP173429	SRR8316895	Juvenile bud stage	61.009
	SRR8316896	Juvenile bud stage	77.541
	SRR8316897	Juvenile bud stage	36.172
	SRR8316894	Third green stage	29.589
	SRR8316900	Third green stage	108.069
	SRR8316901	Third green stage	110.459
	SRR8316898	Complete white stage	42.062
	SRR8316899	Complete white stage	158.833
	SRR8316903	Complete white stage	50.654
	SRR8316902	Silver flowering stage	28.064
	SRR8316904	Silver flowering stage	31.864
	SRR8316905	Silver flowering stage	16.643
	SRR8316906	Gold flowering stage	52.458
	SRR8316907	Gold flowering stage	57.980
	SRR8316908	Gold flowering stage	51.198
SRP132670	SRR6706286	Control	114.449
	SRR6706287	Light intensity 50%	126.928
	SRR6706288	Light intensity 20%	143.250
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	110.958
	CNS0095593	Slightly white alabastrum(diploid) 2	159.170
	CNS0095594	Slightly white alabastrum(diploid) 3	106.180
	CNS0095595	Whole white alabastrum(diploid) 2	118.954
	CNS0095596	Whole white alabastrum(diploid) 3	132.413
	CNS0095597	Whole white alabastrum(diploid) 4	105.963
	CNS0095598	Silvery flower (diploied) 1	60.312
	CNS0095599	Silvery flower (diploied) 2	60.349
	CNS0095600	Silvery flower (diploied) 3	50.301
	CNS0095601	Golden flower (diploid) 1	63.059
	CNS0095602	Golden flower (diploid) 2	44.246
	CNS0095603	Golden flower (diploid) 3	45.782
	CNS0095604	Slightly white alabastrum(tetraploid) 1	107.120
	CNS0095605	Slightly white alabastrum(tetraploid) 2	116.940
	CNS0095606	Slightly white alabastrum(tetraploid) 3	139.479
	CNS0095607	Whole white alabastrum(tetraploid) 1	78.894
	CNS0095608	Whole white alabastrum(tetraploid) 2	85.898
	CNS0095609	Whole white alabastrum(tetraploid) 3	118.508
	CNS0095610	Silvery flower (tetraploid) 1	61.365
	CNS0095611	Silvery flower (tetraploid) 2	47.465
	CNS0095612	Silvery flower (tetraploid) 3	44.315
	CNS0095613	Golden flower (tetraploid) 1	35.241
	CNS0095614	Golden flower (tetraploid) 2	44.060
	CNS0095615	Golden flower (tetraploid) 3	29.432
CRA001975	CRR073297	Stem 1	84.251
	CRR073298	Stem 2	87.393
	CRR073299	Stem 3	70.609
	CRR073300	Leaf 1	105.451
	CRR073301	Leaf 2	107.426
	CRR073302	Leaf 3	95.290
	CRR073303	Juvenile bud 1	107.268
	CRR073304	Juvenile bud 2	73.199
	CRR073305	Juvenile bud 3	71.019
	CRR073306	Third green 1	36.097
	CRR073307	Third green 2	44.576
	CRR073308	Third green 3	44.329
	CRR073309	Second white 1	20.697
	CRR073310	Second white 2	19.075
	CRR073311	Second white 3	12.526
	CRR073312	Silver flowering 1	12.108
	CRR073313	Silver flowering 2	16.857
	CRR073314	Silver flowering 3	13.471
	CRR073315	Gold flowering 1	38.030
	CRR073316	Gold flowering 2	31.830
	CRR073317	Gold flowering 3	23.450
	CRR073318	Tawny withering 1	47.592
	CRR073319	Tawny withering 2	63.389
	CRR073320	Tawny withering 3	48.061