Gene detail

Detail information of GWHGAAZE031229

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010258739.1	1.82777E-97	PREDICTED: nucleoside diphosphate kinase B [Nelumbo nucifera]
COG	NP_441918.1	1E-69	nucleoside diphosphate kinase
Swissprot	tr\|P47920\|NDKB_FLABI	6E-97	Nucleoside diphosphate kinase B
trEMBL	tr\|I1SN93\|I1SN93_HEVBR	1E-95	Nucleoside diphosphate kinase {ECO:0000256\|RuleBase:RU004013}
TAIR10	AT4G09320.1	3E-72	Nucleoside diphosphate kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	55467218	55469490	+
GWHAAZE00000009	mRNA	55467218	55469490	+
GWHAAZE00000009	exon	55467218	55467268	+
GWHAAZE00000009	exon	55467711	55467759	+
GWHAAZE00000009	exon	55468216	55468447	+
GWHAAZE00000009	exon	55469376	55469490	+
GWHAAZE00000009	CDS	55467218	55467268	+
GWHAAZE00000009	CDS	55467711	55467759	+
GWHAAZE00000009	CDS	55468216	55468447	+
GWHAAZE00000009	CDS	55469376	55469490	+

Transcript Sequence
>GWHTAAZE031263 ATGGAGCAGACCTTCATTATGATCAAGCCTGATGGTGTACAAAGAGGACTGGTTGGTGAGATCATTGGAAGATTTGAGAAGAAAGGATTCTCTTTAAAAGGCTTGAAGATGATGACTGTGGAGCAGTCTTTTGCCGAGAGGCACTATGCTGACCTCTCCTCAAAGCCCTTCTTCAATGGTCTGGTTGAGTACATTGTCTCTGGACCAGTGGTTGCAATGGTTTGGGAGGGCAAGAACGTAGTTAAAACCGGCCGCACGATTATTGGTGCCACAAACCCAGCTGACTCTGCTCCTGGAACTATCCGTGGTGACTATGCCATTGACATTGGCAGGAACGTGATTCACGGAAGCGATTCAGTTGAGAGTGCAAGGAAAGAAATTGCTCTGTGGTTCCCAGATGGCGTTGCCCAGTGGCAGAGCAGCCTTCACCCTTGGATCTATGAATGA

Network for GWHGAAZE031229

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00334.20	NDK	2	133	1.60E-56

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00940	ndk, NME	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983
		MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006165	biological_process	nucleoside diphosphate phosphorylation
GO:0006183	biological_process	GTP biosynthetic process
GO:0006228	biological_process	UTP biosynthetic process
GO:0006241	biological_process	CTP biosynthetic process
GO:0004550	molecular_function	nucleoside diphosphate kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	515.450
	SRR3591706	second leaf	543.048
	SRR3591707	mature leaf	392.127
	SRR3591708	Shoot apex	846.655
	SRR3591709	Stem	470.091
	SRR3591710	White floral bud	396.501
	SRR3591711	White flower	550.649
	SRR3591712	Green floral bud	821.241
	SRR3591713	Yellow flower	479.283
SRP173429	SRR8316895	Juvenile bud stage	409.082
	SRR8316896	Juvenile bud stage	476.376
	SRR8316897	Juvenile bud stage	290.421
	SRR8316894	Third green stage	247.830
	SRR8316900	Third green stage	903.869
	SRR8316901	Third green stage	804.862
	SRR8316898	Complete white stage	165.653
	SRR8316899	Complete white stage	832.297
	SRR8316903	Complete white stage	255.012
	SRR8316902	Silver flowering stage	156.988
	SRR8316904	Silver flowering stage	158.424
	SRR8316905	Silver flowering stage	74.327
	SRR8316906	Gold flowering stage	235.993
	SRR8316907	Gold flowering stage	324.733
	SRR8316908	Gold flowering stage	369.514
SRP132670	SRR6706286	Control	1341.406
	SRR6706287	Light intensity 50%	1331.906
	SRR6706288	Light intensity 20%	1460.592
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	902.357
	CNS0095593	Slightly white alabastrum(diploid) 2	1166.508
	CNS0095594	Slightly white alabastrum(diploid) 3	807.952
	CNS0095595	Whole white alabastrum(diploid) 2	824.693
	CNS0095596	Whole white alabastrum(diploid) 3	1026.943
	CNS0095597	Whole white alabastrum(diploid) 4	706.279
	CNS0095598	Silvery flower (diploied) 1	584.061
	CNS0095599	Silvery flower (diploied) 2	512.348
	CNS0095600	Silvery flower (diploied) 3	403.355
	CNS0095601	Golden flower (diploid) 1	458.139
	CNS0095602	Golden flower (diploid) 2	405.307
	CNS0095603	Golden flower (diploid) 3	396.282
	CNS0095604	Slightly white alabastrum(tetraploid) 1	852.774
	CNS0095605	Slightly white alabastrum(tetraploid) 2	892.943
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1185.623
	CNS0095607	Whole white alabastrum(tetraploid) 1	481.507
	CNS0095608	Whole white alabastrum(tetraploid) 2	504.510
	CNS0095609	Whole white alabastrum(tetraploid) 3	972.909
	CNS0095610	Silvery flower (tetraploid) 1	522.647
	CNS0095611	Silvery flower (tetraploid) 2	505.650
	CNS0095612	Silvery flower (tetraploid) 3	350.288
	CNS0095613	Golden flower (tetraploid) 1	324.654
	CNS0095614	Golden flower (tetraploid) 2	417.622
	CNS0095615	Golden flower (tetraploid) 3	216.556
CRA001975	CRR073297	Stem 1	781.822
	CRR073298	Stem 2	848.961
	CRR073299	Stem 3	1150.472
	CRR073300	Leaf 1	902.424
	CRR073301	Leaf 2	1033.480
	CRR073302	Leaf 3	1403.149
	CRR073303	Juvenile bud 1	1257.212
	CRR073304	Juvenile bud 2	979.424
	CRR073305	Juvenile bud 3	841.324
	CRR073306	Third green 1	141.338
	CRR073307	Third green 2	157.870
	CRR073308	Third green 3	160.181
	CRR073309	Second white 1	204.303
	CRR073310	Second white 2	164.796
	CRR073311	Second white 3	99.095
	CRR073312	Silver flowering 1	135.566
	CRR073313	Silver flowering 2	165.180
	CRR073314	Silver flowering 3	131.548
	CRR073315	Gold flowering 1	604.552
	CRR073316	Gold flowering 2	512.555
	CRR073317	Gold flowering 3	492.527
	CRR073318	Tawny withering 1	670.018
	CRR073319	Tawny withering 2	673.537
	CRR073320	Tawny withering 3	674.660