Gene detail

Detail information of GWHGAAZE031126

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002268705.1	4.24017E-70	PREDICTED: 17.4 kDa class III heat shock protein [Vitis vinifera]
COG	YP_005887446.1	4E-12	heat shock protein Hsp20
Swissprot	tr\|Q9SYG1\|HS174_ARATH	5E-45	17.4 kDa class III heat shock protein
trEMBL	tr\|F6HXP8\|F6HXP8_VITVI	2E-70	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB59255.1}
TAIR10	AT1G54050.1	2E-36	HSP20-like chaperones superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	53663006	53663669	+
GWHAAZE00000009	mRNA	53663006	53663669	+
GWHAAZE00000009	exon	53663006	53663221	+
GWHAAZE00000009	exon	53663409	53663669	+
GWHAAZE00000009	CDS	53663006	53663221	+
GWHAAZE00000009	CDS	53663409	53663669	+

Transcript Sequence
>GWHTAAZE031160 ATGAGCAGAGCTGCTGCTGCTGATTCTTTCAATGGAGACATAGGAGGTGTCGTGAATCGTCTTTTGAATTTCCCAGAAACCATTGCCAAGTTGGTATCCCCTCACGAAACCCATGAATCGAAGGGTGCAAGCAGTATTCCCGTGGACATCCTTGATACCCCAAAGGAATACATATTCTACATGGATGTTCCTGGCTTATCCAAGTCTGACATTCAGGTTACTGTAGAGGAAGAGAATACGCTGGTGATAAGAAGCAGTGGGAAGAGGAAAAGGGAAGATAATGGTGAGGAGGAGGGTGATTGCAAGTACTTGAGGCTGGAGAGGAGGGCATCACCTCATAAGGTGCAGAGGAAGTTCAGATTGCCCGAGAATAGCAATGTGTCTGCTATAACTGCCAAATGCGAGAATGGGGTGCTGACTGTGCTGCTTGAGAAGCTGCCACCAAAGTCCAAGACTGTTCAAGTTGCAATTTCTTAG

Network for GWHGAAZE031126

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00011.22	HSP20	49	155	6.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13993	HSP20	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.877
	SRR3591706	second leaf	0.451
	SRR3591707	mature leaf	0.530
	SRR3591708	Shoot apex	9.588
	SRR3591709	Stem	2.149
	SRR3591710	White floral bud	1.946
	SRR3591711	White flower	1.343
	SRR3591712	Green floral bud	1.136
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	70.477
	SRR8316896	Juvenile bud stage	312.978
	SRR8316897	Juvenile bud stage	100.392
	SRR8316894	Third green stage	1.082
	SRR8316900	Third green stage	1.910
	SRR8316901	Third green stage	5.871
	SRR8316898	Complete white stage	0.361
	SRR8316899	Complete white stage	1.356
	SRR8316903	Complete white stage	1.236
	SRR8316902	Silver flowering stage	4.923
	SRR8316904	Silver flowering stage	0.662
	SRR8316905	Silver flowering stage	1.581
	SRR8316906	Gold flowering stage	23.162
	SRR8316907	Gold flowering stage	16.586
	SRR8316908	Gold flowering stage	6.990
SRP132670	SRR6706286	Control	2.628
	SRR6706287	Light intensity 50%	1.225
	SRR6706288	Light intensity 20%	1.606
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.556
	CNS0095593	Slightly white alabastrum(diploid) 2	1.944
	CNS0095594	Slightly white alabastrum(diploid) 3	4.845
	CNS0095595	Whole white alabastrum(diploid) 2	3.038
	CNS0095596	Whole white alabastrum(diploid) 3	1.116
	CNS0095597	Whole white alabastrum(diploid) 4	3.012
	CNS0095598	Silvery flower (diploied) 1	8.541
	CNS0095599	Silvery flower (diploied) 2	276.866
	CNS0095600	Silvery flower (diploied) 3	62.928
	CNS0095601	Golden flower (diploid) 1	664.833
	CNS0095602	Golden flower (diploid) 2	85.783
	CNS0095603	Golden flower (diploid) 3	82.190
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.717
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.959
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.853
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.138
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.017
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.083
	CNS0095610	Silvery flower (tetraploid) 1	9.781
	CNS0095611	Silvery flower (tetraploid) 2	19.251
	CNS0095612	Silvery flower (tetraploid) 3	5.333
	CNS0095613	Golden flower (tetraploid) 1	16.865
	CNS0095614	Golden flower (tetraploid) 2	16.283
	CNS0095615	Golden flower (tetraploid) 3	1.553
CRA001975	CRR073297	Stem 1	0.007
	CRR073298	Stem 2	0.374
	CRR073299	Stem 3	0.516
	CRR073300	Leaf 1	0.680
	CRR073301	Leaf 2	0.469
	CRR073302	Leaf 3	0.079
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.126
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.284
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.023
	CRR073317	Gold flowering 3	0.168
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.290
	CRR073320	Tawny withering 3	0.000