Gene detail

Detail information of GWHGAAZE031089

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14938.1	1.0834E-103	unnamed protein product [Coffea canephora]
COG	YP_001510288.1	3E-26	50S ribosomal protein L24
Swissprot	tr\|A6MW12\|RK24_RHDSA	9E-15	50S ribosomal protein L24, chloroplastic
trEMBL	tr\|A0A068V4X6\|A0A068V4X6_COFCA	4E-104	Coffea canephora DH200=94 genomic scaffold, scaffold_93 {ECO:0000313\|EMBL:CDP14938.1}
TAIR10	AT5G23535.1	2E-76	KOW domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	52978947	52981674	+
GWHAAZE00000009	mRNA	52978947	52981674	+
GWHAAZE00000009	exon	52978947	52979006	+
GWHAAZE00000009	exon	52979131	52979226	+
GWHAAZE00000009	exon	52980542	52980645	+
GWHAAZE00000009	exon	52980738	52980874	+
GWHAAZE00000009	exon	52981592	52981674	+
GWHAAZE00000009	CDS	52978947	52979006	+
GWHAAZE00000009	CDS	52979131	52979226	+
GWHAAZE00000009	CDS	52980542	52980645	+
GWHAAZE00000009	CDS	52980738	52980874	+
GWHAAZE00000009	CDS	52981592	52981674	+

Transcript Sequence
>GWHTAAZE031123 ATGGGTTGGAAGGCAGCTCAAAAACTCATACATCACTGGAAGATTCTAAGAGGCGATAATGTAATGATAATTAGGGGCAAAGATAAAGGTGAGACTGGCATGATTAAGCGTGTGATCCGCTCTCAAAATCGTGTTATTGTGGAGGGAAAAAATTTGGTAAAGAAACATATTAAACAGGGGCAAGGCCATGAAGGAGGGATTTTTACTGTTGAAGCCCCACTTCATGTTTCAAATGTTCAAGTTGTAGACCCGGCAACAGGGAAGCCTTGTAAGGTTGGAATAAGGTATCTTGAAGATGGTACCAAAGTAAGAGTTTCTAGAGGTATAGGTGCATCAGGGTCGATAATACCTCGTCCTGAGATCTTAAAGATAAGGACTACACCAAGACCAACAGTTGCTGGCCCAAAGGACACTCCTATGGATCTGGTTCTGGAGAAGACATACGATGCTAAAACTGGAAAAGGAATGCCTCATCTTTAA

Network for GWHGAAZE031089

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00467.30	KOW	17	48	3.40E-10
PF17136.5	ribosomal_L24	51	108	2.10E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02895	RP-L24, MRPL24, rplX	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.899
	SRR3591706	second leaf	28.272
	SRR3591707	mature leaf	20.003
	SRR3591708	Shoot apex	42.053
	SRR3591709	Stem	32.519
	SRR3591710	White floral bud	11.868
	SRR3591711	White flower	12.440
	SRR3591712	Green floral bud	18.938
	SRR3591713	Yellow flower	13.029
SRP173429	SRR8316895	Juvenile bud stage	14.841
	SRR8316896	Juvenile bud stage	18.807
	SRR8316897	Juvenile bud stage	13.333
	SRR8316894	Third green stage	6.663
	SRR8316900	Third green stage	19.735
	SRR8316901	Third green stage	19.868
	SRR8316898	Complete white stage	3.618
	SRR8316899	Complete white stage	21.859
	SRR8316903	Complete white stage	5.297
	SRR8316902	Silver flowering stage	3.304
	SRR8316904	Silver flowering stage	4.713
	SRR8316905	Silver flowering stage	2.680
	SRR8316906	Gold flowering stage	7.192
	SRR8316907	Gold flowering stage	4.984
	SRR8316908	Gold flowering stage	8.750
SRP132670	SRR6706286	Control	7.224
	SRR6706287	Light intensity 50%	6.478
	SRR6706288	Light intensity 20%	7.190
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.970
	CNS0095593	Slightly white alabastrum(diploid) 2	26.258
	CNS0095594	Slightly white alabastrum(diploid) 3	28.408
	CNS0095595	Whole white alabastrum(diploid) 2	17.165
	CNS0095596	Whole white alabastrum(diploid) 3	21.879
	CNS0095597	Whole white alabastrum(diploid) 4	19.963
	CNS0095598	Silvery flower (diploied) 1	14.994
	CNS0095599	Silvery flower (diploied) 2	14.977
	CNS0095600	Silvery flower (diploied) 3	10.416
	CNS0095601	Golden flower (diploid) 1	13.364
	CNS0095602	Golden flower (diploid) 2	10.652
	CNS0095603	Golden flower (diploid) 3	10.755
	CNS0095604	Slightly white alabastrum(tetraploid) 1	28.945
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.572
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.101
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.082
	CNS0095608	Whole white alabastrum(tetraploid) 2	19.844
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.571
	CNS0095610	Silvery flower (tetraploid) 1	18.135
	CNS0095611	Silvery flower (tetraploid) 2	18.214
	CNS0095612	Silvery flower (tetraploid) 3	17.286
	CNS0095613	Golden flower (tetraploid) 1	11.570
	CNS0095614	Golden flower (tetraploid) 2	19.307
	CNS0095615	Golden flower (tetraploid) 3	4.908
CRA001975	CRR073297	Stem 1	7.588
	CRR073298	Stem 2	6.728
	CRR073299	Stem 3	6.135
	CRR073300	Leaf 1	5.798
	CRR073301	Leaf 2	8.771
	CRR073302	Leaf 3	8.559
	CRR073303	Juvenile bud 1	8.805
	CRR073304	Juvenile bud 2	6.295
	CRR073305	Juvenile bud 3	5.205
	CRR073306	Third green 1	1.176
	CRR073307	Third green 2	2.039
	CRR073308	Third green 3	0.721
	CRR073309	Second white 1	2.143
	CRR073310	Second white 2	2.218
	CRR073311	Second white 3	1.359
	CRR073312	Silver flowering 1	0.960
	CRR073313	Silver flowering 2	1.531
	CRR073314	Silver flowering 3	0.626
	CRR073315	Gold flowering 1	2.583
	CRR073316	Gold flowering 2	5.919
	CRR073317	Gold flowering 3	3.363
	CRR073318	Tawny withering 1	6.352
	CRR073319	Tawny withering 2	3.610
	CRR073320	Tawny withering 3	10.836