Gene detail

Detail information of GWHGAAZE031025

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006342978.1	4.35886E-59	PREDICTED: LOW QUALITY PROTEIN: chaperonin CPN60-like 2, mitochondrial-like [Solanum tuberosum]
COG	YP_007700690.1	1E-30	Chaperon GroL
Swissprot	tr\|Q93ZM7\|CH60C_ARATH	4E-50	Chaperonin CPN60-like 2, mitochondrial (Precursor)
trEMBL	tr\|K4BMW3\|K4BMW3_SOLLC	2E-58	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc03g121640.2.1}
TAIR10	AT3G13860.1	4E-41	heat shock protein 60-3A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	51928915	51931420	+
GWHAAZE00000009	mRNA	51928915	51931420	+
GWHAAZE00000009	exon	51928915	51928955	+
GWHAAZE00000009	exon	51929074	51929095	+
GWHAAZE00000009	exon	51930301	51930432	+
GWHAAZE00000009	exon	51931217	51931420	+
GWHAAZE00000009	CDS	51928915	51928955	+
GWHAAZE00000009	CDS	51929074	51929095	+
GWHAAZE00000009	CDS	51930301	51930432	+
GWHAAZE00000009	CDS	51931217	51931420	+

Transcript Sequence
>GWHTAAZE031059 ATGTATCGGCTCGCTGCAGCCTTTGCTTCATCATCGATCAGGTCCACTACTTCCAGGAGTCTGGTATGTAGTAGGGTTATATCCAGCAGAAACTACGTTGCAAAGGATATTGATTTTGGAACTGGGGCTCGGATGGCCATGTTACAAGGTGTTAATGAGCTTGCCGAAGCTGTGAAGGTCACAATGGGGCCCAAGGGTCGTAATGTGGTTATTGAGAAAAGTCATGGGGGTCCAAAGGTCACAAAGGATGGTGTGACAGTGGCCAAAAGCATCAACTTTAAGGAGAAGGCTAAAAATGTCGGTGCTGATCTAGTGAAGCAGGTTGCCAGTGCTACTAATTCTGCAGCAGGAGATGGTATTTGCTGTTTTTTCTTTCCTTTATGTTGCAGCAGTTCTTAG

Network for GWHGAAZE031025

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00118.25	Cpn60_TCP1	54	119	1.20E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04077	groEL, HSPD1	RNA degradation	map03018
K04077	groEL, HSPD1	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.485
	SRR3591706	second leaf	1.745
	SRR3591707	mature leaf	0.678
	SRR3591708	Shoot apex	11.512
	SRR3591709	Stem	5.394
	SRR3591710	White floral bud	2.568
	SRR3591711	White flower	3.814
	SRR3591712	Green floral bud	3.098
	SRR3591713	Yellow flower	2.343
SRP173429	SRR8316895	Juvenile bud stage	7.813
	SRR8316896	Juvenile bud stage	10.353
	SRR8316897	Juvenile bud stage	5.792
	SRR8316894	Third green stage	4.266
	SRR8316900	Third green stage	7.264
	SRR8316901	Third green stage	7.894
	SRR8316898	Complete white stage	1.386
	SRR8316899	Complete white stage	7.328
	SRR8316903	Complete white stage	3.195
	SRR8316902	Silver flowering stage	1.347
	SRR8316904	Silver flowering stage	2.453
	SRR8316905	Silver flowering stage	1.043
	SRR8316906	Gold flowering stage	2.978
	SRR8316907	Gold flowering stage	3.392
	SRR8316908	Gold flowering stage	5.145
SRP132670	SRR6706286	Control	12.444
	SRR6706287	Light intensity 50%	14.838
	SRR6706288	Light intensity 20%	16.449
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.862
	CNS0095593	Slightly white alabastrum(diploid) 2	2.758
	CNS0095594	Slightly white alabastrum(diploid) 3	5.401
	CNS0095595	Whole white alabastrum(diploid) 2	4.825
	CNS0095596	Whole white alabastrum(diploid) 3	1.046
	CNS0095597	Whole white alabastrum(diploid) 4	4.245
	CNS0095598	Silvery flower (diploied) 1	3.091
	CNS0095599	Silvery flower (diploied) 2	1.984
	CNS0095600	Silvery flower (diploied) 3	2.554
	CNS0095601	Golden flower (diploid) 1	4.514
	CNS0095602	Golden flower (diploid) 2	1.973
	CNS0095603	Golden flower (diploid) 3	3.640
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.343
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.094
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.462
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.551
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.424
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.232
	CNS0095610	Silvery flower (tetraploid) 1	3.735
	CNS0095611	Silvery flower (tetraploid) 2	2.581
	CNS0095612	Silvery flower (tetraploid) 3	3.457
	CNS0095613	Golden flower (tetraploid) 1	1.080
	CNS0095614	Golden flower (tetraploid) 2	2.101
	CNS0095615	Golden flower (tetraploid) 3	0.430
CRA001975	CRR073297	Stem 1	8.881
	CRR073298	Stem 2	7.541
	CRR073299	Stem 3	5.187
	CRR073300	Leaf 1	8.069
	CRR073301	Leaf 2	8.124
	CRR073302	Leaf 3	4.052
	CRR073303	Juvenile bud 1	3.706
	CRR073304	Juvenile bud 2	2.907
	CRR073305	Juvenile bud 3	4.512
	CRR073306	Third green 1	0.338
	CRR073307	Third green 2	0.315
	CRR073308	Third green 3	0.853
	CRR073309	Second white 1	1.613
	CRR073310	Second white 2	2.009
	CRR073311	Second white 3	0.510
	CRR073312	Silver flowering 1	0.022
	CRR073313	Silver flowering 2	0.128
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.873
	CRR073316	Gold flowering 2	3.867
	CRR073317	Gold flowering 3	0.327
	CRR073318	Tawny withering 1	2.927
	CRR073319	Tawny withering 2	1.806
	CRR073320	Tawny withering 3	1.252