Gene detail

Detail information of GWHGAAZE030970

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	BAO49716.1	5.19186E-70	nuclear pore complex protein Sec13b [Nicotiana benthamiana]
COG	YP_007119786.1	1E-12	WD40 repeat-containing protein
Swissprot	tr\|O64740\|SC13B_ARATH	6E-66	Protein transport protein SEC13 homolog B {ECO:0000305}
trEMBL	tr\|W6JLY7\|W6JLY7_NICBE	2E-70	Nuclear pore complex protein Sec13b {ECO:0000313\|EMBL:BAO49716.1}
TAIR10	AT2G30050.1	3E-54	transducin family protein / WD-40 repeat family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	51154302	51155206	-
GWHAAZE00000009	mRNA	51154302	51155206	-
GWHAAZE00000009	exon	51154302	51154679	-
GWHAAZE00000009	exon	51155027	51155206	-
GWHAAZE00000009	CDS	51155027	51155206	-
GWHAAZE00000009	CDS	51154302	51154679	-

Transcript Sequence
>GWHTAAZE031004 ATGCCTTCGCAAAAGATTGAAACTGGTCACCAATATGCGGTCCATGATGTGGCAATGGATTACTATGGCAAGTTTGTCGCAACAGCATCTTCAGACAACACCATTAAGATGATTGGGGTGAGCAACTCGGCCTCTCAGCATCTCACAAATTTGAGTGGTCACCAAGGACCTGTTTGGCAGAAGCTTGTGTCTGGTGGGTGTGATAGTACGGTCAGAGTGTGGAAGCATTACAACAGGGTTTGGAAAATGGATTGTTTCCCTGCTCTTCAAATACATACGGATTGGGTCCGTGATGTTGCTTGGGCACCCAACTTGGGGCTGCCTAAATATACTATTGCGAGTGCCTTTGAAGATGGAAGAGTTATCATATGGACTGAGGCTAAGGAAGGGGATCAGTGGGACGGTAAGGTTTTGAAGGATTTAGAGACCCCTGTTTGGAGGGTGTCTTGGTCGTTAATGGGAAACATACTGGCCGTGGCTGATGGGAAAAACAACGTTACCTTGTGGAAAGAAGCAGTAGATGGTGAGTGGCAACATGTGACAACAGTTGAGTCGTAA

Network for GWHGAAZE030970

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	8	37	0.0031
PF00400.33	WD40	46	75	0.0069
PF00400.33	WD40	89	124	0.22

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
K14004	SEC13	RNA transport	map03013
		Protein processing in endoplasmic reticulum	map04141
		mTOR signaling pathway	map04150

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.338
	SRR3591706	second leaf	1.354
	SRR3591707	mature leaf	1.289
	SRR3591708	Shoot apex	3.232
	SRR3591709	Stem	3.454
	SRR3591710	White floral bud	0.920
	SRR3591711	White flower	0.603
	SRR3591712	Green floral bud	1.703
	SRR3591713	Yellow flower	0.692
SRP173429	SRR8316895	Juvenile bud stage	7.529
	SRR8316896	Juvenile bud stage	10.830
	SRR8316897	Juvenile bud stage	10.354
	SRR8316894	Third green stage	1.811
	SRR8316900	Third green stage	8.574
	SRR8316901	Third green stage	10.060
	SRR8316898	Complete white stage	1.827
	SRR8316899	Complete white stage	15.745
	SRR8316903	Complete white stage	3.183
	SRR8316902	Silver flowering stage	0.589
	SRR8316904	Silver flowering stage	0.708
	SRR8316905	Silver flowering stage	0.341
	SRR8316906	Gold flowering stage	0.570
	SRR8316907	Gold flowering stage	0.768
	SRR8316908	Gold flowering stage	1.191
SRP132670	SRR6706286	Control	4.660
	SRR6706287	Light intensity 50%	4.470
	SRR6706288	Light intensity 20%	4.359
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.002
	CNS0095593	Slightly white alabastrum(diploid) 2	5.223
	CNS0095594	Slightly white alabastrum(diploid) 3	8.730
	CNS0095595	Whole white alabastrum(diploid) 2	5.393
	CNS0095596	Whole white alabastrum(diploid) 3	4.816
	CNS0095597	Whole white alabastrum(diploid) 4	6.184
	CNS0095598	Silvery flower (diploied) 1	6.048
	CNS0095599	Silvery flower (diploied) 2	13.207
	CNS0095600	Silvery flower (diploied) 3	2.185
	CNS0095601	Golden flower (diploid) 1	5.401
	CNS0095602	Golden flower (diploid) 2	2.816
	CNS0095603	Golden flower (diploid) 3	3.904
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.990
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.050
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.651
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.579
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.379
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.592
	CNS0095610	Silvery flower (tetraploid) 1	2.070
	CNS0095611	Silvery flower (tetraploid) 2	2.199
	CNS0095612	Silvery flower (tetraploid) 3	2.426
	CNS0095613	Golden flower (tetraploid) 1	0.792
	CNS0095614	Golden flower (tetraploid) 2	1.558
	CNS0095615	Golden flower (tetraploid) 3	1.244
CRA001975	CRR073297	Stem 1	5.880
	CRR073298	Stem 2	6.689
	CRR073299	Stem 3	3.183
	CRR073300	Leaf 1	9.352
	CRR073301	Leaf 2	11.500
	CRR073302	Leaf 3	2.342
	CRR073303	Juvenile bud 1	2.595
	CRR073304	Juvenile bud 2	2.846
	CRR073305	Juvenile bud 3	5.007
	CRR073306	Third green 1	1.149
	CRR073307	Third green 2	1.024
	CRR073308	Third green 3	1.854
	CRR073309	Second white 1	2.606
	CRR073310	Second white 2	0.752
	CRR073311	Second white 3	0.263
	CRR073312	Silver flowering 1	1.303
	CRR073313	Silver flowering 2	0.780
	CRR073314	Silver flowering 3	0.091
	CRR073315	Gold flowering 1	5.768
	CRR073316	Gold flowering 2	2.473
	CRR073317	Gold flowering 3	2.031
	CRR073318	Tawny withering 1	3.728
	CRR073319	Tawny withering 2	3.548
	CRR073320	Tawny withering 3	4.467