Gene detail

Detail information of GWHGAAZE030864

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009363957.1	6.02073E-78	PREDICTED: ethylene-responsive transcription factor ERF003 [Pyrus x bretschneideri]
Swissprot	tr\|Q94AW5\|ERF03_ARATH	1E-66	Ethylene-responsive transcription factor ERF003
trEMBL	tr\|D5L105\|D5L105_MALDO	2E-77	AP2 domain class transcription factor {ECO:0000313\|EMBL:ADE41114.1}
TAIR10	AT5G25190.1	8E-45	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	49548877	49549512	+
GWHAAZE00000009	mRNA	49548877	49549512	+
GWHAAZE00000009	exon	49548877	49548959	+
GWHAAZE00000009	exon	49549089	49549512	+
GWHAAZE00000009	CDS	49548877	49548959	+
GWHAAZE00000009	CDS	49549089	49549512	+

Transcript Sequence
>GWHTAAZE030898 ATGGCTAGGCCTCAACCACGATACCGGGGGGTTCGCCAGCGTCACTGGGGCTCTTGGGTCTCCGAAATTCGCCATCCCCTACTGAAGACTAGAATATGGCTTGGCACATTTGAGACAGCTGAGGATGCAGCTCGAGCATACGATGAAGCGGCTAGGCTCATGTCGGGGCCAAGGGCACGTACTAATTTTGTTTACAATGAAAATGAGTACTCTCATTCAACTCCATCCAAGCTTCTATCTCCTACTTTAACTGCTAAACTACAAAGATGCCACTTGACATCTCTCCAAATGACCAAAAGACCTCTACCTAAAGAGGCTCAAGAACCTCAATCCCCTTGTGTTTCTAGTGAAGATAGTACCGGAAAATCGGTGAATTGGGTAAGTAATGAGGGTCAAGTGGAGAGTTCACAACAGTTCAAGTCTCTTGAAGATGATCACATAGAGCAAATGATAGAGGAGTTGCTTCATTATGGGTCCATTGAGCTCTGTTCTGTTATGCAAAATTAG

Network for GWHGAAZE030864

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	6	55	3.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.445
	SRR3591706	second leaf	2.757
	SRR3591707	mature leaf	1.826
	SRR3591708	Shoot apex	3.855
	SRR3591709	Stem	5.649
	SRR3591710	White floral bud	10.243
	SRR3591711	White flower	0.162
	SRR3591712	Green floral bud	20.504
	SRR3591713	Yellow flower	0.237
SRP173429	SRR8316895	Juvenile bud stage	0.456
	SRR8316896	Juvenile bud stage	2.505
	SRR8316897	Juvenile bud stage	0.098
	SRR8316894	Third green stage	2.402
	SRR8316900	Third green stage	31.648
	SRR8316901	Third green stage	19.443
	SRR8316898	Complete white stage	7.085
	SRR8316899	Complete white stage	21.260
	SRR8316903	Complete white stage	5.720
	SRR8316902	Silver flowering stage	1.018
	SRR8316904	Silver flowering stage	0.465
	SRR8316905	Silver flowering stage	0.126
	SRR8316906	Gold flowering stage	0.156
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.620
SRP132670	SRR6706286	Control	28.425
	SRR6706287	Light intensity 50%	38.499
	SRR6706288	Light intensity 20%	36.213
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.849
	CNS0095593	Slightly white alabastrum(diploid) 2	16.098
	CNS0095594	Slightly white alabastrum(diploid) 3	4.013
	CNS0095595	Whole white alabastrum(diploid) 2	36.214
	CNS0095596	Whole white alabastrum(diploid) 3	29.945
	CNS0095597	Whole white alabastrum(diploid) 4	32.641
	CNS0095598	Silvery flower (diploied) 1	0.137
	CNS0095599	Silvery flower (diploied) 2	1.141
	CNS0095600	Silvery flower (diploied) 3	0.767
	CNS0095601	Golden flower (diploid) 1	1.435
	CNS0095602	Golden flower (diploid) 2	0.184
	CNS0095603	Golden flower (diploid) 3	0.590
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.954
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.188
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.078
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.772
	CNS0095608	Whole white alabastrum(tetraploid) 2	32.533
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.292
	CNS0095610	Silvery flower (tetraploid) 1	0.566
	CNS0095611	Silvery flower (tetraploid) 2	0.496
	CNS0095612	Silvery flower (tetraploid) 3	0.487
	CNS0095613	Golden flower (tetraploid) 1	0.048
	CNS0095614	Golden flower (tetraploid) 2	1.016
	CNS0095615	Golden flower (tetraploid) 3	0.341
CRA001975	CRR073297	Stem 1	1.558
	CRR073298	Stem 2	2.426
	CRR073299	Stem 3	1.255
	CRR073300	Leaf 1	22.966
	CRR073301	Leaf 2	28.170
	CRR073302	Leaf 3	18.389
	CRR073303	Juvenile bud 1	21.879
	CRR073304	Juvenile bud 2	14.221
	CRR073305	Juvenile bud 3	22.061
	CRR073306	Third green 1	1.922
	CRR073307	Third green 2	1.235
	CRR073308	Third green 3	1.327
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.448
	CRR073317	Gold flowering 3	1.252
	CRR073318	Tawny withering 1	0.459
	CRR073319	Tawny withering 2	0.626
	CRR073320	Tawny withering 3	1.131