Gene detail

Detail information of GWHGAAZE030848

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008669205.1	3.0739E-44	PREDICTED: uncharacterized protein LOC100216672 [Zea mays]
COG	YP_005441838.1	2E-22	3-methyladenine DNA glycosylase
trEMBL	tr\|A0A096RII4\|A0A096RII4_MAIZE	1E-44	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GRMZM2G097573_P01}
TAIR10	AT5G57970.2	3E-35	DNA glycosylase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	49323225	49324329	+
GWHAAZE00000009	mRNA	49323225	49324329	+
GWHAAZE00000009	exon	49323225	49323280	+
GWHAAZE00000009	exon	49323394	49323477	+
GWHAAZE00000009	exon	49323610	49323768	+
GWHAAZE00000009	exon	49324191	49324329	+
GWHAAZE00000009	CDS	49323225	49323280	+
GWHAAZE00000009	CDS	49323394	49323477	+
GWHAAZE00000009	CDS	49323610	49323768	+
GWHAAZE00000009	CDS	49324191	49324329	+

Transcript Sequence
>GWHTAAZE030882 CCCTGTTACGCTGCTTTTCATGATGTAGAATGGGGAGTTCCAGTCCATGATGACAAGAAACTGTTTGAAGTGCTCAGCTTATCCACGGCTTTGGCTGAACTTTCTTGGCCTGCCATTCTCAATAAAAGGAATATATTTAGAAAAGTATTTCAAGAATTTGACCCTATTGTTGTGTCAAAAATAAATGAGAAGAAGGCAGTTACACCTACAAGCCCTGCGAGCTGTCTCCTATCGGAGCTCAAGCTGCGAGGGTTTCTTGAAAATGCACGTCAAATCTACAAGGTTTGTGCTAATTATTTATTCCAGGATTGTAAAGAAGCAGGTGATGAGCGGCATACAGAGGACAATAGCTTCACTTTTGAGGCCAAAGGGAAACTCAAACAAGCTCAGGATGAAACTCACCTGGTACTTGCAAACGCTCTTGATGACGTGAGTTAA

Network for GWHGAAZE030848

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03352.14	Adenine_glyco	1	99	5.30E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01246	tag	Base excision repair	map03410

Gene Ontology

GO term	Ontology	Name
GO:0006281	biological_process	DNA repair
GO:0006284	biological_process	base-excision repair
GO:0003824	molecular_function	catalytic activity
GO:0008725	molecular_function	DNA-3-methyladenine glycosylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.343
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.642
	SRR3591709	Stem	0.097
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.237
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.267
	SRR8316896	Juvenile bud stage	0.677
	SRR8316897	Juvenile bud stage	0.179
	SRR8316894	Third green stage	0.124
	SRR8316900	Third green stage	0.084
	SRR8316901	Third green stage	0.171
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.110
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.070
	SRR8316905	Silver flowering stage	0.035
	SRR8316906	Gold flowering stage	0.104
	SRR8316907	Gold flowering stage	0.087
	SRR8316908	Gold flowering stage	0.031
SRP132670	SRR6706286	Control	0.039
	SRR6706287	Light intensity 50%	0.094
	SRR6706288	Light intensity 20%	0.083
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.725
	CNS0095593	Slightly white alabastrum(diploid) 2	0.356
	CNS0095594	Slightly white alabastrum(diploid) 3	0.394
	CNS0095595	Whole white alabastrum(diploid) 2	0.064
	CNS0095596	Whole white alabastrum(diploid) 3	0.284
	CNS0095597	Whole white alabastrum(diploid) 4	0.322
	CNS0095598	Silvery flower (diploied) 1	0.114
	CNS0095599	Silvery flower (diploied) 2	0.182
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.208
	CNS0095602	Golden flower (diploid) 2	0.085
	CNS0095603	Golden flower (diploid) 3	0.001
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.289
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.160
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.005
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.283
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.200
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.124
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.007
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.074
CRA001975	CRR073297	Stem 1	0.362
	CRR073298	Stem 2	0.121
	CRR073299	Stem 3	0.058
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.060
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.066
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.180
	CRR073316	Gold flowering 2	0.103
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.113
	CRR073320	Tawny withering 3	0.095