Gene detail

Detail information of GWHGAAZE030799

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006446931.1	4.80227E-30	hypothetical protein CICLE_v10017122mg [Citrus clementina]
Swissprot	tr\|C0HJB3\|MANA_CANEN	2E-17	Alpha-mannosidase, light subunit {ECO:0000303\|PubMed:24221485}
trEMBL	tr\|V4UD58\|V4UD58_9ROSI	2E-30	Uncharacterized protein {ECO:0000313\|EMBL:ESR60171.1}
TAIR10	AT3G26720.1	6E-17	Glycosyl hydrolase family 38 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	48628299	48628638	-
GWHAAZE00000009	mRNA	48628299	48628638	-
GWHAAZE00000009	exon	48628299	48628511	-
GWHAAZE00000009	exon	48628597	48628638	-
GWHAAZE00000009	CDS	48628597	48628638	-
GWHAAZE00000009	CDS	48628299	48628511	-

Transcript Sequence
>GWHTAAZE030833 ATGACAAGAGTAGAATTGAAGAAACTATTCCCAAATAGAAAGATAAACAAAGTTTCTGAAATGAGTGGATACGCTAATCAAGAAGGAGAGGAAATGGGGAAGAAAAGATTAGTACGGAGAGCAGAAGGCTCTGAGGATGAAGAATCTAATGTAATAAGAGGTGGTCCTGTCGATCCTGCAAAGCTGGCGGTGGAACTTGCCCCAATGGAAATACGGACATTCATCATCGATTTCTGTTACGAGCCCACCTCCTGA

Network for GWHGAAZE030799

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01191	MAN2C1	Other glycan degradation	map00511

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0030246	molecular_function	carbohydrate binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.656
	SRR3591706	second leaf	1.026
	SRR3591707	mature leaf	1.595
	SRR3591708	Shoot apex	0.945
	SRR3591709	Stem	2.165
	SRR3591710	White floral bud	0.466
	SRR3591711	White flower	1.076
	SRR3591712	Green floral bud	2.256
	SRR3591713	Yellow flower	0.737
SRP173429	SRR8316895	Juvenile bud stage	0.910
	SRR8316896	Juvenile bud stage	1.376
	SRR8316897	Juvenile bud stage	0.889
	SRR8316894	Third green stage	0.312
	SRR8316900	Third green stage	2.702
	SRR8316901	Third green stage	2.098
	SRR8316898	Complete white stage	0.128
	SRR8316899	Complete white stage	0.889
	SRR8316903	Complete white stage	0.848
	SRR8316902	Silver flowering stage	0.436
	SRR8316904	Silver flowering stage	1.089
	SRR8316905	Silver flowering stage	0.687
	SRR8316906	Gold flowering stage	0.900
	SRR8316907	Gold flowering stage	1.283
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.454
	SRR6706287	Light intensity 50%	1.146
	SRR6706288	Light intensity 20%	0.647
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.444
	CNS0095593	Slightly white alabastrum(diploid) 2	2.573
	CNS0095594	Slightly white alabastrum(diploid) 3	4.182
	CNS0095595	Whole white alabastrum(diploid) 2	3.749
	CNS0095596	Whole white alabastrum(diploid) 3	1.079
	CNS0095597	Whole white alabastrum(diploid) 4	2.836
	CNS0095598	Silvery flower (diploied) 1	0.898
	CNS0095599	Silvery flower (diploied) 2	0.667
	CNS0095600	Silvery flower (diploied) 3	1.072
	CNS0095601	Golden flower (diploid) 1	3.043
	CNS0095602	Golden flower (diploid) 2	0.466
	CNS0095603	Golden flower (diploid) 3	2.700
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.380
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.128
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.389
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.197
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.549
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.538
	CNS0095610	Silvery flower (tetraploid) 1	1.162
	CNS0095611	Silvery flower (tetraploid) 2	0.131
	CNS0095612	Silvery flower (tetraploid) 3	0.268
	CNS0095613	Golden flower (tetraploid) 1	0.429
	CNS0095614	Golden flower (tetraploid) 2	0.895
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.304
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.518
	CRR073301	Leaf 2	0.190
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.233
	CRR073304	Juvenile bud 2	0.148
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.287
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.298
	CRR073318	Tawny withering 1	0.467
	CRR073319	Tawny withering 2	0.695
	CRR073320	Tawny withering 3	0.000