Gene detail

Detail information of GWHGAAZE030681

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011072903.1	7.76947E-43	PREDICTED: ATP synthase subunit gamma, mitochondrial [Sesamum indicum]
Swissprot	tr\|P26360\|ATPG3_IPOBA	1E-43	ATP synthase subunit gamma, mitochondrial (Precursor)
trEMBL	tr\|M1CAI4\|M1CAI4_SOLTU	4E-42	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400063336}
TAIR10	AT2G33040.1	9E-27	gamma subunit of Mt ATP synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	47113791	47115417	+
GWHAAZE00000009	mRNA	47113791	47115417	+
GWHAAZE00000009	exon	47113791	47113935	+
GWHAAZE00000009	exon	47115037	47115117	+
GWHAAZE00000009	exon	47115281	47115417	+
GWHAAZE00000009	CDS	47113791	47113935	+
GWHAAZE00000009	CDS	47115037	47115117	+
GWHAAZE00000009	CDS	47115281	47115417	+

Transcript Sequence
>GWHTAAZE030715 ATGAAGAGCGTGAAGAATATCCAAAAAATTAAAAATGCAATATTGAAGATGGTTGCAGCTTCAAAGCTGCGAGCTATTCAATCTAGAGCTGAAAATTCCCGTGGCCTTTGGCAGCCATTCACTACTCTTCTTGGTGACACTCCAAATTTCCTCTTGTATGCTTTTGGTGCTTTATTAGGTGTTGGTGTCAAGAAGAATGTTGTCGTGACGATTTCTTCAGATAAAGGTCCTGATAAAGAGAGTAAATCTGTCATTTTGGGAGAAAAGGCAAAAGCTCAACTGATAAGGGACTCAAAGAAGGATATCGAGTTATCCCTTACGGAATTGCAGAAAAAACTTTCTGAATTACACTCAGGTAGCTGA

Network for GWHGAAZE030681

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02136	ATPeF1G, ATP5C1, ATP3	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0045261	cellular_component	proton-transporting ATP synthase complex, catalytic core F(1)
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.709
	SRR3591706	second leaf	0.567
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.316
	SRR3591709	Stem	0.801
	SRR3591710	White floral bud	0.141
	SRR3591711	White flower	0.202
	SRR3591712	Green floral bud	0.670
	SRR3591713	Yellow flower	0.593
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.416
	SRR8316897	Juvenile bud stage	0.235
	SRR8316894	Third green stage	0.127
	SRR8316900	Third green stage	0.671
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.180
	SRR8316899	Complete white stage	0.458
	SRR8316903	Complete white stage	0.096
	SRR8316902	Silver flowering stage	0.163
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.161
	SRR8316906	Gold flowering stage	0.174
	SRR8316907	Gold flowering stage	0.403
	SRR8316908	Gold flowering stage	0.349
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.027
	SRR6706288	Light intensity 20%	0.032
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.105
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.062
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.072
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.374
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.118
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.078
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.268
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.294
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.402
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.831
	CNS0095610	Silvery flower (tetraploid) 1	0.208
	CNS0095611	Silvery flower (tetraploid) 2	0.666
	CNS0095612	Silvery flower (tetraploid) 3	0.260
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.083
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.225
	CRR073298	Stem 2	0.475
	CRR073299	Stem 3	0.053
	CRR073300	Leaf 1	0.368
	CRR073301	Leaf 2	0.147
	CRR073302	Leaf 3	0.448
	CRR073303	Juvenile bud 1	0.134
	CRR073304	Juvenile bud 2	0.341
	CRR073305	Juvenile bud 3	0.022
	CRR073306	Third green 1	0.337
	CRR073307	Third green 2	0.454
	CRR073308	Third green 3	0.303
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.025
	CRR073312	Silver flowering 1	0.225
	CRR073313	Silver flowering 2	0.230
	CRR073314	Silver flowering 3	0.090
	CRR073315	Gold flowering 1	0.420
	CRR073316	Gold flowering 2	0.044
	CRR073317	Gold flowering 3	0.037
	CRR073318	Tawny withering 1	0.806
	CRR073319	Tawny withering 2	0.053
	CRR073320	Tawny withering 3	0.087