Gene detail

Detail information of GWHGAAZE030570

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002511471.1	2.11485E-81	two-component sensor protein histidine protein kinase, putative [Ricinus communis]
COG	YP_002249856.1	2E-15	chemotaxis protein CheY
Swissprot	tr\|Q9SB04\|ARR5_ARATH	8E-75	Two-component response regulator ARR5
trEMBL	tr\|B9R8Z6\|B9R8Z6_RICCO	8E-82	Two-component sensor protein histidine protein kinase, putative {ECO:0000313\|EMBL:EEF52073.1}
TAIR10	AT3G48100.1	8E-52	response regulator 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	45497252	45498531	+
GWHAAZE00000009	mRNA	45497252	45498531	+
GWHAAZE00000009	exon	45497252	45497396	+
GWHAAZE00000009	exon	45497534	45497610	+
GWHAAZE00000009	exon	45497729	45497806	+
GWHAAZE00000009	exon	45497918	45497988	+
GWHAAZE00000009	exon	45498300	45498531	+
GWHAAZE00000009	CDS	45497252	45497396	+
GWHAAZE00000009	CDS	45497534	45497610	+
GWHAAZE00000009	CDS	45497729	45497806	+
GWHAAZE00000009	CDS	45497918	45497988	+
GWHAAZE00000009	CDS	45498300	45498531	+

Transcript Sequence
>GWHTAAZE030604 ATGGCGAGAACGGTGTGGAGGGAGTCGCCGAAGAAGTTGGAAGTTTCCGACCGATCATCGGCAGAGCTACATGTTCTTGCCGTTGATGACAGTCTCGTGGATCGAAGGGTTATTGAGCGATTGCTTAAGATTTCTTCTTGTAAAGTGACGGCTGTGGAGAGCGGAAGCAGAGCACTTCAATATCTTGGATTAGATGGAAATAAGGACTCTATTGGATTTCAGGATTTGAAGGTGAATCTGATAATGACGGACTATTCTATGCCTGGGATGACAGGATATGAACTACTCAAGAAAATCAAGACATCTTCAACATTGAGCAAAATACCAGTGGTAATCATGTCTTCAGAGAACATCATGGCTCGCATTGATAGGTGTTTGGAGGAAGGAGCAGAGGATTTCTTATTGAAGCCAGTAAAGCTTTCGGATGTGAAGCGATTGAAAGATTTCATATTGAAAGGAGAGGAAACTGTAGAAGAGAAAGTAACCACCCACAAGAGAAAATTAACAGATGGCCATGATCCTTCGCCAGAATCACCCTCATCGTCAATTGAATATGATCCATCATCTCCGTCGCCCTCCGCCCCAAAGCGACCTAGATTATAG

Network for GWHGAAZE030570

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00072.25	Response_reg	25	143	1.30E-21

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.627
	SRR3591706	second leaf	11.672
	SRR3591707	mature leaf	4.462
	SRR3591708	Shoot apex	25.031
	SRR3591709	Stem	9.073
	SRR3591710	White floral bud	4.815
	SRR3591711	White flower	7.470
	SRR3591712	Green floral bud	16.711
	SRR3591713	Yellow flower	1.278
SRP173429	SRR8316895	Juvenile bud stage	2.455
	SRR8316896	Juvenile bud stage	7.089
	SRR8316897	Juvenile bud stage	2.839
	SRR8316894	Third green stage	16.830
	SRR8316900	Third green stage	133.977
	SRR8316901	Third green stage	101.361
	SRR8316898	Complete white stage	3.735
	SRR8316899	Complete white stage	27.101
	SRR8316903	Complete white stage	7.022
	SRR8316902	Silver flowering stage	1.528
	SRR8316904	Silver flowering stage	1.272
	SRR8316905	Silver flowering stage	0.783
	SRR8316906	Gold flowering stage	1.647
	SRR8316907	Gold flowering stage	2.384
	SRR8316908	Gold flowering stage	2.711
SRP132670	SRR6706286	Control	60.597
	SRR6706287	Light intensity 50%	60.219
	SRR6706288	Light intensity 20%	58.136
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.713
	CNS0095593	Slightly white alabastrum(diploid) 2	61.952
	CNS0095594	Slightly white alabastrum(diploid) 3	18.546
	CNS0095595	Whole white alabastrum(diploid) 2	49.763
	CNS0095596	Whole white alabastrum(diploid) 3	65.336
	CNS0095597	Whole white alabastrum(diploid) 4	21.058
	CNS0095598	Silvery flower (diploied) 1	12.830
	CNS0095599	Silvery flower (diploied) 2	8.538
	CNS0095600	Silvery flower (diploied) 3	3.577
	CNS0095601	Golden flower (diploid) 1	7.827
	CNS0095602	Golden flower (diploid) 2	5.397
	CNS0095603	Golden flower (diploid) 3	4.172
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.779
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.477
	CNS0095606	Slightly white alabastrum(tetraploid) 3	79.178
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.636
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.769
	CNS0095609	Whole white alabastrum(tetraploid) 3	44.353
	CNS0095610	Silvery flower (tetraploid) 1	4.427
	CNS0095611	Silvery flower (tetraploid) 2	5.949
	CNS0095612	Silvery flower (tetraploid) 3	1.583
	CNS0095613	Golden flower (tetraploid) 1	0.981
	CNS0095614	Golden flower (tetraploid) 2	5.372
	CNS0095615	Golden flower (tetraploid) 3	0.924
CRA001975	CRR073297	Stem 1	34.216
	CRR073298	Stem 2	67.665
	CRR073299	Stem 3	33.315
	CRR073300	Leaf 1	94.026
	CRR073301	Leaf 2	126.660
	CRR073302	Leaf 3	76.405
	CRR073303	Juvenile bud 1	21.862
	CRR073304	Juvenile bud 2	5.706
	CRR073305	Juvenile bud 3	19.057
	CRR073306	Third green 1	0.226
	CRR073307	Third green 2	2.604
	CRR073308	Third green 3	0.903
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.520
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.115
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.817
	CRR073316	Gold flowering 2	4.712
	CRR073317	Gold flowering 3	4.104
	CRR073318	Tawny withering 1	4.499
	CRR073319	Tawny withering 2	3.769
	CRR073320	Tawny withering 3	5.447