Gene detail

Detail information of GWHGAAZE030491

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG00891.1	5.8229E-54	DEAD-box ATP-dependent RNA helicase 30 [Gossypium arboreum]
COG	YP_003279706.1	6E-14	hypothetical protein CtCNB1_3664
Swissprot	tr\|Q5N7W4\|RH30_ORYSJ	2E-44	DEAD-box ATP-dependent RNA helicase 30
trEMBL	tr\|A0A061FVC8\|A0A061FVC8_THECC	3E-54	P-loop containing nucleoside triphosphate hydrolases superfamily protein isoform 1 {ECO:0000313\|EMBL:EOY20827.1}
TAIR10	AT5G63120.2	2E-18	P-loop containing nucleoside triphosphate hydrolases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	44353191	44354230	+
GWHAAZE00000009	mRNA	44353191	44354230	+
GWHAAZE00000009	exon	44353191	44353291	+
GWHAAZE00000009	exon	44353387	44353577	+
GWHAAZE00000009	exon	44353731	44353964	+
GWHAAZE00000009	exon	44354133	44354230	+
GWHAAZE00000009	CDS	44353191	44353291	+
GWHAAZE00000009	CDS	44353387	44353577	+
GWHAAZE00000009	CDS	44353731	44353964	+
GWHAAZE00000009	CDS	44354133	44354230	+

Transcript Sequence
>GWHTAAZE030525 ATGGACACAGGGAGCACTTTTTTTGCAGATCTAGCTAGGATACTTGGTCTGAGGCAAAGGATGCCCATTTTTCAAGTTGAGGCCATTATCTATCTTTGTAGAATTTTCAAGAAATGGCAAAGCTCCAATGATTGTGTCTACGTAACATGGTTGAAGTTATCGCTGCCCATCCCTGGTTATGGAGCTGGTTATTGTGACAGCCCGGTTGACTCATACAAAAGCTTATTCATTGACTGGTTTTATGCATTTGGGAGTTGTGGTGGTGATGGAGCTGCTCCTTATCCCTGTAAAGATGTGAAGGATATAAAATGTGTGATCAACTATGATTTCCCATCCAGTCTTGAGGATTATGTTCACAGGATTGGTCGAACCGGTCGAGCAGGAGCCAAGGGAACTGCTCTCACTTTTTTCACACATGCAAATGCAAAGTTTGCTAAAGATCTTATTAAGATTCTTCAAGAAGCAGGACAAATTGTTCCTCCTGCATTGTCTGCACTGGCCCGATCTGCTGGTTCTGGTCTAGGAGCTTCCAAGGGGAATTTCAGATCCAGAGGACGGGGAGGCTTTGGCAATCGAATTTCAGGATCTAACACTGTTCCTATTGGCGGGAAAACATTTTGGTAG

Network for GWHGAAZE030491

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00271.32	Helicase_C	98	128	7.00E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12823	DDX5, DBP2	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.781
	SRR3591706	second leaf	21.815
	SRR3591707	mature leaf	25.952
	SRR3591708	Shoot apex	41.716
	SRR3591709	Stem	60.829
	SRR3591710	White floral bud	71.923
	SRR3591711	White flower	89.271
	SRR3591712	Green floral bud	101.593
	SRR3591713	Yellow flower	54.120
SRP173429	SRR8316895	Juvenile bud stage	76.151
	SRR8316896	Juvenile bud stage	139.243
	SRR8316897	Juvenile bud stage	62.500
	SRR8316894	Third green stage	51.766
	SRR8316900	Third green stage	98.933
	SRR8316901	Third green stage	129.094
	SRR8316898	Complete white stage	39.164
	SRR8316899	Complete white stage	140.132
	SRR8316903	Complete white stage	88.073
	SRR8316902	Silver flowering stage	63.278
	SRR8316904	Silver flowering stage	79.947
	SRR8316905	Silver flowering stage	30.818
	SRR8316906	Gold flowering stage	73.682
	SRR8316907	Gold flowering stage	93.839
	SRR8316908	Gold flowering stage	103.013
SRP132670	SRR6706286	Control	50.165
	SRR6706287	Light intensity 50%	60.153
	SRR6706288	Light intensity 20%	68.192
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	101.299
	CNS0095593	Slightly white alabastrum(diploid) 2	104.270
	CNS0095594	Slightly white alabastrum(diploid) 3	98.323
	CNS0095595	Whole white alabastrum(diploid) 2	75.974
	CNS0095596	Whole white alabastrum(diploid) 3	66.860
	CNS0095597	Whole white alabastrum(diploid) 4	95.427
	CNS0095598	Silvery flower (diploied) 1	106.346
	CNS0095599	Silvery flower (diploied) 2	73.491
	CNS0095600	Silvery flower (diploied) 3	55.452
	CNS0095601	Golden flower (diploid) 1	86.316
	CNS0095602	Golden flower (diploid) 2	53.806
	CNS0095603	Golden flower (diploid) 3	51.996
	CNS0095604	Slightly white alabastrum(tetraploid) 1	80.206
	CNS0095605	Slightly white alabastrum(tetraploid) 2	66.752
	CNS0095606	Slightly white alabastrum(tetraploid) 3	87.862
	CNS0095607	Whole white alabastrum(tetraploid) 1	58.021
	CNS0095608	Whole white alabastrum(tetraploid) 2	51.694
	CNS0095609	Whole white alabastrum(tetraploid) 3	59.376
	CNS0095610	Silvery flower (tetraploid) 1	106.934
	CNS0095611	Silvery flower (tetraploid) 2	79.793
	CNS0095612	Silvery flower (tetraploid) 3	130.559
	CNS0095613	Golden flower (tetraploid) 1	95.829
	CNS0095614	Golden flower (tetraploid) 2	75.377
	CNS0095615	Golden flower (tetraploid) 3	57.339
CRA001975	CRR073297	Stem 1	186.140
	CRR073298	Stem 2	144.965
	CRR073299	Stem 3	47.429
	CRR073300	Leaf 1	165.496
	CRR073301	Leaf 2	158.035
	CRR073302	Leaf 3	30.066
	CRR073303	Juvenile bud 1	35.289
	CRR073304	Juvenile bud 2	12.439
	CRR073305	Juvenile bud 3	40.483
	CRR073306	Third green 1	10.086
	CRR073307	Third green 2	7.115
	CRR073308	Third green 3	13.388
	CRR073309	Second white 1	11.683
	CRR073310	Second white 2	16.983
	CRR073311	Second white 3	11.496
	CRR073312	Silver flowering 1	20.034
	CRR073313	Silver flowering 2	22.008
	CRR073314	Silver flowering 3	22.011
	CRR073315	Gold flowering 1	38.505
	CRR073316	Gold flowering 2	46.609
	CRR073317	Gold flowering 3	18.244
	CRR073318	Tawny withering 1	84.463
	CRR073319	Tawny withering 2	126.477
	CRR073320	Tawny withering 3	67.543