Gene detail

Detail information of GWHGAAZE030322

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009757600.1	4.0178E-115	PREDICTED: RNA polymerase II subunit A C-terminal domain phosphatase SSU72 [Nicotiana sylvestris]
trEMBL	tr\|K4BJL5\|K4BJL5_SOLLC	4E-113	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc03g097990.2.1}
TAIR10	AT1G73820.1	8E-83	Ssu72-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	41590396	41594100	+
GWHAAZE00000009	mRNA	41590396	41594100	+
GWHAAZE00000009	exon	41590396	41590577	+
GWHAAZE00000009	exon	41590841	41590986	+
GWHAAZE00000009	exon	41593796	41593914	+
GWHAAZE00000009	exon	41593999	41594100	+
GWHAAZE00000009	CDS	41590396	41590577	+
GWHAAZE00000009	CDS	41590841	41590986	+
GWHAAZE00000009	CDS	41593796	41593914	+
GWHAAZE00000009	CDS	41593999	41594100	+

Transcript Sequence
>GWHTAAZE030356 ATGAAACTTCGATACGCGATGGTATGTTCGTCAAATCAGAACCGTAGCATGGAAGCTCACTGTATCCTCAAGAGAGAGGGCTTCGATGTATCCTCATACGGAACTGGGCAACACGTTAAGCTCCCTGGTCCATCCGCCAGAGAACCCAACGTCTACGAGTTTGGTACTCCCTACAAGCACATGTACAAGCGTAATGGTATATTGCCGATGCTTAAGAGGAACTCAAATGTCAAAACCGCACCTCAACGATGGCAAGAGAATGCAGCTGATGGTTACTTTGATGTCGTATTCACGTTTGAAGAAAAAGTTTTTGATAATGTCCTTGAAGATCTCCACACTCGGGACCAGTTACTTATGAAACCAGTGTTGGTGATCAACTTGGAAGTAAAAGATAACCATGAGGAAGCGGCAATAGGAGCTCGGCTTACTCTAATTCTGTGCCAAGAGCTTGAAGGTACTGAAAATTGGGAGGATTCAATTGATGATATAATCACAACTTTTGAGAGACAGCACCGAAGGAAGCTCGTATATAGTATCTCCTTCTATTGA

Network for GWHGAAZE030322

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04722.14	Ssu72	3	182	7.10E-71

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15544	SSU72	mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0006397	biological_process	mRNA processing
GO:0005634	cellular_component	nucleus
GO:0004721	molecular_function	phosphoprotein phosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.214
	SRR3591706	second leaf	13.205
	SRR3591707	mature leaf	9.132
	SRR3591708	Shoot apex	26.229
	SRR3591709	Stem	18.001
	SRR3591710	White floral bud	10.680
	SRR3591711	White flower	15.776
	SRR3591712	Green floral bud	16.225
	SRR3591713	Yellow flower	13.369
SRP173429	SRR8316895	Juvenile bud stage	11.432
	SRR8316896	Juvenile bud stage	14.217
	SRR8316897	Juvenile bud stage	7.721
	SRR8316894	Third green stage	5.193
	SRR8316900	Third green stage	16.178
	SRR8316901	Third green stage	17.315
	SRR8316898	Complete white stage	6.543
	SRR8316899	Complete white stage	14.067
	SRR8316903	Complete white stage	6.780
	SRR8316902	Silver flowering stage	5.618
	SRR8316904	Silver flowering stage	6.170
	SRR8316905	Silver flowering stage	4.298
	SRR8316906	Gold flowering stage	14.017
	SRR8316907	Gold flowering stage	11.253
	SRR8316908	Gold flowering stage	10.789
SRP132670	SRR6706286	Control	12.682
	SRR6706287	Light intensity 50%	10.851
	SRR6706288	Light intensity 20%	11.978
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.121
	CNS0095593	Slightly white alabastrum(diploid) 2	11.857
	CNS0095594	Slightly white alabastrum(diploid) 3	14.811
	CNS0095595	Whole white alabastrum(diploid) 2	11.415
	CNS0095596	Whole white alabastrum(diploid) 3	10.271
	CNS0095597	Whole white alabastrum(diploid) 4	7.380
	CNS0095598	Silvery flower (diploied) 1	7.674
	CNS0095599	Silvery flower (diploied) 2	9.723
	CNS0095600	Silvery flower (diploied) 3	11.604
	CNS0095601	Golden flower (diploid) 1	8.427
	CNS0095602	Golden flower (diploid) 2	8.364
	CNS0095603	Golden flower (diploid) 3	10.038
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.757
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.505
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.479
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.684
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.335
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.800
	CNS0095610	Silvery flower (tetraploid) 1	12.340
	CNS0095611	Silvery flower (tetraploid) 2	12.979
	CNS0095612	Silvery flower (tetraploid) 3	11.579
	CNS0095613	Golden flower (tetraploid) 1	10.541
	CNS0095614	Golden flower (tetraploid) 2	8.479
	CNS0095615	Golden flower (tetraploid) 3	12.260
CRA001975	CRR073297	Stem 1	14.572
	CRR073298	Stem 2	13.049
	CRR073299	Stem 3	13.617
	CRR073300	Leaf 1	7.579
	CRR073301	Leaf 2	9.954
	CRR073302	Leaf 3	13.608
	CRR073303	Juvenile bud 1	6.933
	CRR073304	Juvenile bud 2	6.279
	CRR073305	Juvenile bud 3	8.025
	CRR073306	Third green 1	2.044
	CRR073307	Third green 2	1.832
	CRR073308	Third green 3	2.440
	CRR073309	Second white 1	2.686
	CRR073310	Second white 2	4.714
	CRR073311	Second white 3	3.352
	CRR073312	Silver flowering 1	4.920
	CRR073313	Silver flowering 2	4.192
	CRR073314	Silver flowering 3	1.984
	CRR073315	Gold flowering 1	6.964
	CRR073316	Gold flowering 2	9.993
	CRR073317	Gold flowering 3	7.406
	CRR073318	Tawny withering 1	12.327
	CRR073319	Tawny withering 2	9.582
	CRR073320	Tawny withering 3	8.887