Gene detail

Detail information of GWHGAAZE030313

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009770258.1	5.03498E-72	PREDICTED: transcriptional activator Myb-like [Nicotiana sylvestris]
Swissprot	tr\|Q9FDW1\|MYB44_ARATH	7E-40	Transcription factor MYB44
trEMBL	tr\|D7SGT6\|D7SGT6_VITVI	3E-72	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI15616.3}
TAIR10	AT1G17950.1	3E-56	myb domain protein 52

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	41444289	41445405	+
GWHAAZE00000009	mRNA	41444289	41445405	+
GWHAAZE00000009	exon	41444289	41444409	+
GWHAAZE00000009	exon	41444969	41445405	+
GWHAAZE00000009	CDS	41444289	41444409	+
GWHAAZE00000009	CDS	41444969	41445405	+

Transcript Sequence
>GWHTAAZE030347 ATGAAAATGTGCAGCAGAGGGCATTGGAGGCCTGGTGAGGATGAGAAACTCAGGGAACTAGTCCAACGCTATGGTCCTCACAACTGGAATGCCATTGCGCAATATCTACCTGGAAGATCAGGTAAGAGTTGTAGGTTGAGATGGTTCAATCAGTTGGACCCGAGAATCAATCGAAATCCATTTACAGAAGAGGAAGAGGAAAGGCTACTTTCTGCTCATCGAATTCATGGGAATCGATGGTCTATCATTGCTCGGCTTTTTCCAGGCCGTACTGATAACGCTGTGAAGAATCACTGGCATGTCATAATGGCTCGAAGATGCAGAGATCAACGGACAAGATTTTACGCCAAGAGACCGTCTCATTTAAAACATGATGATCATGTGCATGGACAGCAGCAAATGAACTGCGGGGCAAAAAATTTCTCAGTTCAATTATTTGGATACCCTTTCACAGATCATAACCTAATTTCTCAAAATCTAGTAGAGCTCCACTCCAACCACTTGATTCATCATATGAAGATGGGCGAAGGTACCTCGAATTTTAGTAGAACTAATTAA

Network for GWHGAAZE030313

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	6	51	5.00E-17
PF00249.32	Myb_DNA-binding	58	101	1.90E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.346
	SRR3591706	second leaf	0.540
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	12.160
	SRR3591710	White floral bud	0.154
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.389
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.877
	SRR8316896	Juvenile bud stage	0.869
	SRR8316897	Juvenile bud stage	0.181
	SRR8316894	Third green stage	0.102
	SRR8316900	Third green stage	0.190
	SRR8316901	Third green stage	0.404
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.299
	SRR6706287	Light intensity 50%	0.101
	SRR6706288	Light intensity 20%	0.302
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.707
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.674
	CNS0095595	Whole white alabastrum(diploid) 2	0.079
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.123
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.476
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.042
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.107
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.102
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.005
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.754
	CRR073298	Stem 2	1.043
	CRR073299	Stem 3	0.172
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.802
	CRR073302	Leaf 3	0.436
	CRR073303	Juvenile bud 1	0.016
	CRR073304	Juvenile bud 2	0.067
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.015
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	5.675
	CRR073319	Tawny withering 2	1.810
	CRR073320	Tawny withering 3	6.197