Gene detail

Detail information of GWHGAAZE030187

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007041872.1	6.27162E-71	Actin depolymerizing factor 5 [Theobroma cacao]
Swissprot	tr\|Q9ZNT3\|ADF5_ARATH	2E-68	Actin-depolymerizing factor 5
trEMBL	tr\|A0A061E643\|A0A061E643_THECC	2E-71	Actin depolymerizing factor 5 {ECO:0000313\|EMBL:EOX97703.1}
TAIR10	AT2G16700.1	8E-49	actin depolymerizing factor 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	39218677	39220248	+
GWHAAZE00000009	mRNA	39218677	39220248	+
GWHAAZE00000009	exon	39218677	39218879	+
GWHAAZE00000009	exon	39220098	39220248	+
GWHAAZE00000009	CDS	39218677	39218879	+
GWHAAZE00000009	CDS	39220098	39220248	+

Transcript Sequence
>GWHTAAZE030221 ATGGAAAAAGTGCACAGATACATAGTCTACAAAATCGACGAAAAGTCTAGGCTAGTCACCGTCGATAAGGTTGGCGCGGCAGGCGAAGGCTACGCCGAACTCGCTGCCTCACTGCCGACCGACGATTGTAGATACGCAGTCTTCGATTTCGATTTTGTCACCGTCGATAATTGCCGGAAGAGCAAGATCTTCTTCATTGCATGGGCACCGGCTGCATCAAGAATAAGAGCAAAAGTGCTATATGCGACCTCAAAAGATGGGCTGAGGAGAGTACTTGATGGTATCCACTATGAGGTCCAGGCCACCGACCCAACTGAGATGGGTTTTGATATCATCAAGGACCAGGCCAATTGA

Network for GWHGAAZE030187

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	4	114	2.30E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	174.515
	SRR3591706	second leaf	33.402
	SRR3591707	mature leaf	11.694
	SRR3591708	Shoot apex	134.337
	SRR3591709	Stem	355.839
	SRR3591710	White floral bud	28.794
	SRR3591711	White flower	35.989
	SRR3591712	Green floral bud	14.797
	SRR3591713	Yellow flower	114.646
SRP173429	SRR8316895	Juvenile bud stage	37.633
	SRR8316896	Juvenile bud stage	30.073
	SRR8316897	Juvenile bud stage	15.173
	SRR8316894	Third green stage	15.067
	SRR8316900	Third green stage	34.736
	SRR8316901	Third green stage	40.690
	SRR8316898	Complete white stage	70.846
	SRR8316899	Complete white stage	81.941
	SRR8316903	Complete white stage	95.914
	SRR8316902	Silver flowering stage	31.430
	SRR8316904	Silver flowering stage	47.552
	SRR8316905	Silver flowering stage	20.163
	SRR8316906	Gold flowering stage	35.936
	SRR8316907	Gold flowering stage	41.567
	SRR8316908	Gold flowering stage	46.001
SRP132670	SRR6706286	Control	56.576
	SRR6706287	Light intensity 50%	54.454
	SRR6706288	Light intensity 20%	47.423
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	42.832
	CNS0095593	Slightly white alabastrum(diploid) 2	62.078
	CNS0095594	Slightly white alabastrum(diploid) 3	37.435
	CNS0095595	Whole white alabastrum(diploid) 2	23.924
	CNS0095596	Whole white alabastrum(diploid) 3	14.464
	CNS0095597	Whole white alabastrum(diploid) 4	25.166
	CNS0095598	Silvery flower (diploied) 1	43.375
	CNS0095599	Silvery flower (diploied) 2	53.301
	CNS0095600	Silvery flower (diploied) 3	49.314
	CNS0095601	Golden flower (diploid) 1	37.355
	CNS0095602	Golden flower (diploid) 2	73.654
	CNS0095603	Golden flower (diploid) 3	62.269
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.113
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.992
	CNS0095606	Slightly white alabastrum(tetraploid) 3	153.842
	CNS0095607	Whole white alabastrum(tetraploid) 1	70.986
	CNS0095608	Whole white alabastrum(tetraploid) 2	55.895
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.403
	CNS0095610	Silvery flower (tetraploid) 1	83.488
	CNS0095611	Silvery flower (tetraploid) 2	56.521
	CNS0095612	Silvery flower (tetraploid) 3	37.236
	CNS0095613	Golden flower (tetraploid) 1	37.702
	CNS0095614	Golden flower (tetraploid) 2	39.590
	CNS0095615	Golden flower (tetraploid) 3	73.367
CRA001975	CRR073297	Stem 1	67.114
	CRR073298	Stem 2	66.809
	CRR073299	Stem 3	61.311
	CRR073300	Leaf 1	34.421
	CRR073301	Leaf 2	51.690
	CRR073302	Leaf 3	37.543
	CRR073303	Juvenile bud 1	42.383
	CRR073304	Juvenile bud 2	50.075
	CRR073305	Juvenile bud 3	57.023
	CRR073306	Third green 1	186.397
	CRR073307	Third green 2	229.323
	CRR073308	Third green 3	200.877
	CRR073309	Second white 1	33.552
	CRR073310	Second white 2	22.865
	CRR073311	Second white 3	13.133
	CRR073312	Silver flowering 1	25.040
	CRR073313	Silver flowering 2	26.948
	CRR073314	Silver flowering 3	19.715
	CRR073315	Gold flowering 1	7.350
	CRR073316	Gold flowering 2	28.175
	CRR073317	Gold flowering 3	8.396
	CRR073318	Tawny withering 1	120.934
	CRR073319	Tawny withering 2	95.246
	CRR073320	Tawny withering 3	120.545