Gene detail

Detail information of GWHGAAZE030099

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011088486.1	1.1733E-128	PREDICTED: endoglucanase 24-like [Sesamum indicum]
COG	YP_290232.1	5E-54	endoglucanase
Swissprot	tr\|Q93YQ7\|GUN24_ARATH	1E-121	Endoglucanase 24 (Precursor)
trEMBL	tr\|C7EC60\|C7EC60_9ROSI	2E-128	Endoglucanase {ECO:0000256\|RuleBase:RU361166}
TAIR10	AT4G39010.1	7E-89	glycosyl hydrolase 9B18

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	38280005	38284742	+
GWHAAZE00000009	mRNA	38280005	38284742	+
GWHAAZE00000009	exon	38280005	38280436	+
GWHAAZE00000009	exon	38284425	38284742	+
GWHAAZE00000009	CDS	38280005	38280436	+
GWHAAZE00000009	CDS	38284425	38284742	+

Transcript Sequence
>GWHTAAZE030133 ATGAAAATGAAATCCTCCTCTTCACTCTACCCCCTCATATTCCTTCTCTCCTTCCTACTCGTCCATCAATTCCCATGTTACGAATCAGCCTCTCACGATTACTTAGACGCATTGTCCAAATCCATAATTTTCTTCGAGGGCCAGCGCTCCGGGTTCCTGCCGCAGGACCAGAGGATATCCTGGCGCGCAAACTCCGGCCTCGGCGACGGATCGACAATGAACGTCGACTTGACCGGAGGTTATTATGATGCCGGTGATAACATTAAGTTCGGGTTTCCGATGGCGTTTACGACGACAATGTTGGCTTGGAGTGTGGTGGAGTTCGGAGAGGGGATGCCGGCCGGAGAGTTTAGGAATGCTCTTGTGGCTATTCGATGGGCGACGGATTATCTTCTCAAGACGGTTTCTCAGACCAATCGGATTTTCGTGCAGGTAGGTGATCCGAATATAGACCATAACTGCTGGGAAAGACCAGAAGACATGGATACAGCTCGAACCGTCTACACCGTGGATGCACCAAACCCAGCTTCTGATGTAGCTGGAGAGACCGCTGCAGCTCTGGCTGCTTCGTCCATGGCATTTCGATCTTCAGATCCAGGTTATGCCGAGACCCTGTTAAGAACTGCAGCTAGGGTGTTTGATTATGCTGATACTTATCGAGGTGCTTATAGCGACAATGCAGATATTAAGAATGGTGCTTGCCCATTTTATTGTGATTTTGATGGATATCAGGCAAGCCATTTCCTCTAA

Network for GWHGAAZE030099

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00759.20	Glyco_hydro_9	34	243	3.80E-74

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01179	E3.2.1.4	Metabolic pathways	map01100
		Starch and sucrose metabolism	map00500
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.951
	SRR3591706	second leaf	31.905
	SRR3591707	mature leaf	2.169
	SRR3591708	Shoot apex	18.335
	SRR3591709	Stem	1.325
	SRR3591710	White floral bud	1.253
	SRR3591711	White flower	0.336
	SRR3591712	Green floral bud	1.661
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.101
	SRR8316896	Juvenile bud stage	3.523
	SRR8316897	Juvenile bud stage	1.280
	SRR8316894	Third green stage	1.701
	SRR8316900	Third green stage	4.815
	SRR8316901	Third green stage	2.657
	SRR8316898	Complete white stage	0.333
	SRR8316899	Complete white stage	3.751
	SRR8316903	Complete white stage	0.431
	SRR8316902	Silver flowering stage	0.189
	SRR8316904	Silver flowering stage	0.387
	SRR8316905	Silver flowering stage	0.092
	SRR8316906	Gold flowering stage	0.079
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.129
SRP132670	SRR6706286	Control	4.635
	SRR6706287	Light intensity 50%	5.728
	SRR6706288	Light intensity 20%	5.495
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.307
	CNS0095593	Slightly white alabastrum(diploid) 2	3.909
	CNS0095594	Slightly white alabastrum(diploid) 3	4.199
	CNS0095595	Whole white alabastrum(diploid) 2	1.682
	CNS0095596	Whole white alabastrum(diploid) 3	2.129
	CNS0095597	Whole white alabastrum(diploid) 4	1.480
	CNS0095598	Silvery flower (diploied) 1	0.757
	CNS0095599	Silvery flower (diploied) 2	0.806
	CNS0095600	Silvery flower (diploied) 3	1.151
	CNS0095601	Golden flower (diploid) 1	0.934
	CNS0095602	Golden flower (diploid) 2	1.591
	CNS0095603	Golden flower (diploid) 3	0.789
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.533
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.435
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.403
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.521
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.211
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.510
	CNS0095610	Silvery flower (tetraploid) 1	0.211
	CNS0095611	Silvery flower (tetraploid) 2	1.184
	CNS0095612	Silvery flower (tetraploid) 3	0.415
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.226
	CNS0095615	Golden flower (tetraploid) 3	0.096
CRA001975	CRR073297	Stem 1	7.515
	CRR073298	Stem 2	9.027
	CRR073299	Stem 3	9.465
	CRR073300	Leaf 1	16.404
	CRR073301	Leaf 2	8.529
	CRR073302	Leaf 3	14.246
	CRR073303	Juvenile bud 1	6.801
	CRR073304	Juvenile bud 2	12.972
	CRR073305	Juvenile bud 3	7.586
	CRR073306	Third green 1	0.493
	CRR073307	Third green 2	1.541
	CRR073308	Third green 3	0.711
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.119
	CRR073311	Second white 3	0.176
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.004
	CRR073317	Gold flowering 3	0.281
	CRR073318	Tawny withering 1	7.198
	CRR073319	Tawny withering 2	1.724
	CRR073320	Tawny withering 3	8.235