Gene detail

Detail information of GWHGAAZE030067

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002512945.1	1.55717E-56	Ocs element-binding factor, putative [Ricinus communis]
Swissprot	tr\|P24068\|OCS1_MAIZE	2E-20	Ocs element-binding factor 1
trEMBL	tr\|B9RH86\|B9RH86_RICCO	6E-57	Ocs element-binding factor, putative {ECO:0000313\|EMBL:EEF49448.1}
TAIR10	AT4G34590.1	3E-32	G-box binding factor 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	37679013	37679450	+
GWHAAZE00000009	mRNA	37679013	37679450	+
GWHAAZE00000009	exon	37679013	37679450	+
GWHAAZE00000009	CDS	37679013	37679450	+

Transcript Sequence
>GWHTAAZE030101 ATGGATTCGTCGAGTGGGACCACTTCAGGATCCACACTGCTTCAGAACTCTGGCTCAGATGAAGATCTGCTGCAACTAATGGAACAGAGGAAGAGGAGGAGGTTAATTTCGAATCGCGAGTCGGCTCGGCGATCCCGGATGAAGAAACAGAAAAGATTGAGCGAGTTGATGACTCAGCTGAGTCAACTGAGGAAGGAGAACAATCAGATTATTGCGAGTTTGAGATTTACTAGTCAACATTTTGTAAATGTGGAGGCAGAGAACTCTGTTTTGAGGGCTCAAGTGGGTGAACTTAGCCACAGATTGGAGTCTTTAAATGAAATCGTCAGTTTCTTGAGTGTTGGTGAACCTGGGGGTGAGTTTATCAATGAGTCTTTGAGTTATTTGTATTTGAATCAGCCTGTTATGGCCTCTGCTGCTGATATGTTGATGTACTGA

Network for GWHGAAZE030067

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	29	72	3.90E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	119.360
	SRR3591706	second leaf	103.455
	SRR3591707	mature leaf	80.935
	SRR3591708	Shoot apex	81.067
	SRR3591709	Stem	186.777
	SRR3591710	White floral bud	71.654
	SRR3591711	White flower	38.530
	SRR3591712	Green floral bud	169.146
	SRR3591713	Yellow flower	7.659
SRP173429	SRR8316895	Juvenile bud stage	78.277
	SRR8316896	Juvenile bud stage	94.090
	SRR8316897	Juvenile bud stage	45.655
	SRR8316894	Third green stage	48.732
	SRR8316900	Third green stage	168.499
	SRR8316901	Third green stage	197.236
	SRR8316898	Complete white stage	26.338
	SRR8316899	Complete white stage	225.107
	SRR8316903	Complete white stage	67.815
	SRR8316902	Silver flowering stage	24.745
	SRR8316904	Silver flowering stage	18.856
	SRR8316905	Silver flowering stage	3.480
	SRR8316906	Gold flowering stage	7.417
	SRR8316907	Gold flowering stage	15.687
	SRR8316908	Gold flowering stage	10.813
SRP132670	SRR6706286	Control	81.222
	SRR6706287	Light intensity 50%	74.929
	SRR6706288	Light intensity 20%	89.731
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	130.100
	CNS0095593	Slightly white alabastrum(diploid) 2	178.036
	CNS0095594	Slightly white alabastrum(diploid) 3	157.668
	CNS0095595	Whole white alabastrum(diploid) 2	144.758
	CNS0095596	Whole white alabastrum(diploid) 3	113.751
	CNS0095597	Whole white alabastrum(diploid) 4	128.395
	CNS0095598	Silvery flower (diploied) 1	31.776
	CNS0095599	Silvery flower (diploied) 2	64.834
	CNS0095600	Silvery flower (diploied) 3	47.764
	CNS0095601	Golden flower (diploid) 1	23.836
	CNS0095602	Golden flower (diploid) 2	9.854
	CNS0095603	Golden flower (diploid) 3	10.489
	CNS0095604	Slightly white alabastrum(tetraploid) 1	180.433
	CNS0095605	Slightly white alabastrum(tetraploid) 2	190.667
	CNS0095606	Slightly white alabastrum(tetraploid) 3	218.645
	CNS0095607	Whole white alabastrum(tetraploid) 1	151.891
	CNS0095608	Whole white alabastrum(tetraploid) 2	117.914
	CNS0095609	Whole white alabastrum(tetraploid) 3	108.315
	CNS0095610	Silvery flower (tetraploid) 1	24.102
	CNS0095611	Silvery flower (tetraploid) 2	10.068
	CNS0095612	Silvery flower (tetraploid) 3	13.917
	CNS0095613	Golden flower (tetraploid) 1	2.143
	CNS0095614	Golden flower (tetraploid) 2	4.759
	CNS0095615	Golden flower (tetraploid) 3	1.227
CRA001975	CRR073297	Stem 1	102.081
	CRR073298	Stem 2	94.386
	CRR073299	Stem 3	110.252
	CRR073300	Leaf 1	163.931
	CRR073301	Leaf 2	135.530
	CRR073302	Leaf 3	152.180
	CRR073303	Juvenile bud 1	227.680
	CRR073304	Juvenile bud 2	141.452
	CRR073305	Juvenile bud 3	152.612
	CRR073306	Third green 1	16.542
	CRR073307	Third green 2	17.660
	CRR073308	Third green 3	21.626
	CRR073309	Second white 1	2.370
	CRR073310	Second white 2	4.354
	CRR073311	Second white 3	2.613
	CRR073312	Silver flowering 1	1.923
	CRR073313	Silver flowering 2	0.453
	CRR073314	Silver flowering 3	0.291
	CRR073315	Gold flowering 1	60.285
	CRR073316	Gold flowering 2	47.370
	CRR073317	Gold flowering 3	30.346
	CRR073318	Tawny withering 1	88.892
	CRR073319	Tawny withering 2	113.322
	CRR073320	Tawny withering 3	45.408