Gene detail

Detail information of GWHGAAZE029952

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008454945.1	7.95299E-57	PREDICTED: ethylene-responsive transcription factor ERF109-like [Cucumis melo]
Swissprot	tr\|Q9SZ06\|EF109_ARATH	5E-38	Ethylene-responsive transcription factor ERF109
trEMBL	tr\|A0A097LG53\|A0A097LG53_9ROSA	2E-54	EREBP-like factor {ECO:0000313\|EMBL:AIU05286.1}
TAIR10	AT4G34410.1	9E-28	redox responsive transcription factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	35814525	35815258	+
GWHAAZE00000009	mRNA	35814525	35815258	+
GWHAAZE00000009	exon	35814525	35815055	+
GWHAAZE00000009	exon	35815247	35815258	+
GWHAAZE00000009	CDS	35814525	35815055	+
GWHAAZE00000009	CDS	35815247	35815258	+

Transcript Sequence
>GWHTAAZE029986 ATGCAAAACTCACCCAAAAGACCCAGAATTCCAATTACTCCCTCCACCACCGCGCCACCACCTCCACGGCGGCTCACTGAGGAGCAAGAATTTTCCGTCATGGTCGGCGCGCTAAAAACCGTCATTACTGGCAGCGCCACCTCAGCTCCCCAATTCCAATTATTCCAAGAATGCACCACCACCGCCACTTCATCCGCAGGTACATCTTCGCCGTTTGAACAGGTGTCGATCTCGGCGCCCGATACGTGTAAAATTTGCAGAATCAACGGGTGCTTAGGCTGCGATTTTTTCGAGGATAAAGATAAGAACAGCCGGGTGATCAAGAAAAAGAAGAATAATTACAGAGGAGTGAGGCAAAGGCCGTGGGGAAAATGGGCAGCCGAGATTCGGGACCCGCAAAAGGCCGCTCGGGTCTGGCTCGGGACTTTCGAAACTGCTGAGGCAGCTGCTCGGGCTTATGACCAAGCCGCCATTAAATTTAGGGGACCCAGAGCGAAGCTCAATTTTGGGTTTTCGGATTATACATTGGCGAAACTTTCGTAG

Network for GWHGAAZE029952

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	113	162	1.20E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.892
	SRR3591706	second leaf	1.856
	SRR3591707	mature leaf	0.552
	SRR3591708	Shoot apex	2.198
	SRR3591709	Stem	9.680
	SRR3591710	White floral bud	15.651
	SRR3591711	White flower	9.626
	SRR3591712	Green floral bud	3.861
	SRR3591713	Yellow flower	6.510
SRP173429	SRR8316895	Juvenile bud stage	128.248
	SRR8316896	Juvenile bud stage	88.218
	SRR8316897	Juvenile bud stage	123.525
	SRR8316894	Third green stage	3.969
	SRR8316900	Third green stage	6.059
	SRR8316901	Third green stage	34.922
	SRR8316898	Complete white stage	0.484
	SRR8316899	Complete white stage	88.932
	SRR8316903	Complete white stage	1.093
	SRR8316902	Silver flowering stage	1.480
	SRR8316904	Silver flowering stage	0.590
	SRR8316905	Silver flowering stage	1.086
	SRR8316906	Gold flowering stage	7.037
	SRR8316907	Gold flowering stage	8.925
	SRR8316908	Gold flowering stage	1.848
SRP132670	SRR6706286	Control	0.525
	SRR6706287	Light intensity 50%	0.106
	SRR6706288	Light intensity 20%	0.278
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	49.614
	CNS0095593	Slightly white alabastrum(diploid) 2	106.438
	CNS0095594	Slightly white alabastrum(diploid) 3	127.328
	CNS0095595	Whole white alabastrum(diploid) 2	105.728
	CNS0095596	Whole white alabastrum(diploid) 3	1.841
	CNS0095597	Whole white alabastrum(diploid) 4	63.253
	CNS0095598	Silvery flower (diploied) 1	219.416
	CNS0095599	Silvery flower (diploied) 2	345.997
	CNS0095600	Silvery flower (diploied) 3	91.186
	CNS0095601	Golden flower (diploid) 1	219.008
	CNS0095602	Golden flower (diploid) 2	104.582
	CNS0095603	Golden flower (diploid) 3	108.654
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.083
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.001
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.001
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.400
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.230
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.292
	CNS0095611	Silvery flower (tetraploid) 2	0.160
	CNS0095612	Silvery flower (tetraploid) 3	3.148
	CNS0095613	Golden flower (tetraploid) 1	0.553
	CNS0095614	Golden flower (tetraploid) 2	0.060
	CNS0095615	Golden flower (tetraploid) 3	0.011
CRA001975	CRR073297	Stem 1	6.877
	CRR073298	Stem 2	8.184
	CRR073299	Stem 3	7.765
	CRR073300	Leaf 1	6.865
	CRR073301	Leaf 2	23.896
	CRR073302	Leaf 3	4.914
	CRR073303	Juvenile bud 1	6.475
	CRR073304	Juvenile bud 2	72.788
	CRR073305	Juvenile bud 3	25.392
	CRR073306	Third green 1	9.280
	CRR073307	Third green 2	15.357
	CRR073308	Third green 3	6.560
	CRR073309	Second white 1	9.426
	CRR073310	Second white 2	10.361
	CRR073311	Second white 3	11.643
	CRR073312	Silver flowering 1	55.689
	CRR073313	Silver flowering 2	24.943
	CRR073314	Silver flowering 3	15.631
	CRR073315	Gold flowering 1	14.509
	CRR073316	Gold flowering 2	53.971
	CRR073317	Gold flowering 3	55.284
	CRR073318	Tawny withering 1	16.750
	CRR073319	Tawny withering 2	268.826
	CRR073320	Tawny withering 3	17.700