Gene detail

Detail information of GWHGAAZE029768

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97259.1	8.5031E-82	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9ZS51\|PMP22_ARATH	7E-10	Peroxisomal membrane protein PMP22
trEMBL	tr\|A0A068TMV0\|A0A068TMV0_COFCA	3E-82	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO97259.1}
TAIR10	AT2G14860.1	5E-61	Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	32627208	32629645	+
GWHAAZE00000009	mRNA	32627208	32629645	+
GWHAAZE00000009	exon	32627208	32627212	+
GWHAAZE00000009	exon	32627392	32627747	+
GWHAAZE00000009	exon	32629289	32629413	+
GWHAAZE00000009	exon	32629532	32629645	+
GWHAAZE00000009	CDS	32627208	32627212	+
GWHAAZE00000009	CDS	32627392	32627747	+
GWHAAZE00000009	CDS	32629289	32629413	+
GWHAAZE00000009	CDS	32629532	32629645	+

Transcript Sequence
>GWHTAAZE029802 ATGAGAATTGTAACTGATCATATTAACTGTCGCTGTGTGTTTGTTGAATTATATTTGTATCCAATGCTCCGAGGGAGATATTTAGTGTTTGGGAATTTCAGTATTTCACACATTGCTTCTACTTTTCTCCAGACACTGTCACGACAAGCTTCAGAGTCTTATGATCTAGTGAGGACGTTACGAATGGCTGGATATGGAATGATAATTTTAGGACCATCATTACATTTCTGGTTCAATTTTGTATCGAAAGTACTTCCTAAGCGAGATCTCAATGCAACATTGAAAAAGATTATCATGGGGCAGATTATATACGGACCTATTATGACTGTTGTTTTTTTCTCCTTGAATGCCGGTCTACAAGGTGAAAGCAGATCAGAGATAATTGCTCGATTGAGACGTGACTTGATTCCTACGATGCTAAGTGGTGTTATGTACTGGCCCTTGTGTGATTTTATTACATTCAGATTCATTCCTGTTCATTTGCAGCCATTGGTAAGCAATTCGTTTGCGTTTCTGTGGAATGTTTACTTAACATACATGGCAAACTGTGAGAAAGTGCCGCTGGCACAACTATCCGTGCAAACTACGGATTCTACTTGA

Network for GWHGAAZE029768

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04117.13	Mpv17_PMP22	119	177	5.20E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13348	MPV17	Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.552
	SRR3591706	second leaf	13.927
	SRR3591707	mature leaf	6.880
	SRR3591708	Shoot apex	16.217
	SRR3591709	Stem	11.463
	SRR3591710	White floral bud	20.529
	SRR3591711	White flower	25.943
	SRR3591712	Green floral bud	14.080
	SRR3591713	Yellow flower	14.652
SRP173429	SRR8316895	Juvenile bud stage	45.340
	SRR8316896	Juvenile bud stage	27.423
	SRR8316897	Juvenile bud stage	31.201
	SRR8316894	Third green stage	6.817
	SRR8316900	Third green stage	12.870
	SRR8316901	Third green stage	16.992
	SRR8316898	Complete white stage	5.647
	SRR8316899	Complete white stage	32.449
	SRR8316903	Complete white stage	7.014
	SRR8316902	Silver flowering stage	8.349
	SRR8316904	Silver flowering stage	6.284
	SRR8316905	Silver flowering stage	3.800
	SRR8316906	Gold flowering stage	14.307
	SRR8316907	Gold flowering stage	13.385
	SRR8316908	Gold flowering stage	16.185
SRP132670	SRR6706286	Control	5.950
	SRR6706287	Light intensity 50%	7.421
	SRR6706288	Light intensity 20%	7.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.722
	CNS0095593	Slightly white alabastrum(diploid) 2	27.405
	CNS0095594	Slightly white alabastrum(diploid) 3	33.107
	CNS0095595	Whole white alabastrum(diploid) 2	34.635
	CNS0095596	Whole white alabastrum(diploid) 3	6.097
	CNS0095597	Whole white alabastrum(diploid) 4	17.097
	CNS0095598	Silvery flower (diploied) 1	40.970
	CNS0095599	Silvery flower (diploied) 2	81.998
	CNS0095600	Silvery flower (diploied) 3	31.116
	CNS0095601	Golden flower (diploid) 1	63.822
	CNS0095602	Golden flower (diploid) 2	45.392
	CNS0095603	Golden flower (diploid) 3	45.326
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.982
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.256
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.024
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.928
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.663
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.262
	CNS0095610	Silvery flower (tetraploid) 1	8.070
	CNS0095611	Silvery flower (tetraploid) 2	5.959
	CNS0095612	Silvery flower (tetraploid) 3	5.277
	CNS0095613	Golden flower (tetraploid) 1	4.270
	CNS0095614	Golden flower (tetraploid) 2	7.367
	CNS0095615	Golden flower (tetraploid) 3	4.250
CRA001975	CRR073297	Stem 1	8.497
	CRR073298	Stem 2	8.439
	CRR073299	Stem 3	8.389
	CRR073300	Leaf 1	5.309
	CRR073301	Leaf 2	8.149
	CRR073302	Leaf 3	3.570
	CRR073303	Juvenile bud 1	4.578
	CRR073304	Juvenile bud 2	3.583
	CRR073305	Juvenile bud 3	7.051
	CRR073306	Third green 1	8.324
	CRR073307	Third green 2	5.136
	CRR073308	Third green 3	4.851
	CRR073309	Second white 1	5.896
	CRR073310	Second white 2	7.377
	CRR073311	Second white 3	3.244
	CRR073312	Silver flowering 1	4.663
	CRR073313	Silver flowering 2	4.745
	CRR073314	Silver flowering 3	3.860
	CRR073315	Gold flowering 1	2.687
	CRR073316	Gold flowering 2	15.988
	CRR073317	Gold flowering 3	10.543
	CRR073318	Tawny withering 1	5.823
	CRR073319	Tawny withering 2	39.868
	CRR073320	Tawny withering 3	3.518